Signa Vitae. 2021; 17(5): 142-150. doi: 10.22514/sv.2021.137
Original Research

miR-187 modulates cardiomyocyte apoptosis and oxidative stress in myocardial infarction mice via negatively regulating DYRK2

Fen Zhu1,*,, Zhili Yu1, Dongsheng Li1

1Department of Cardiology, Wuhan Third Hospital & Tongren Hospital of Wuhan University, 430060 Wuhan, Hubei, China

*Corresponding Author(s):ADCB67iu95@163.com (Fen Zhu)

History Submitted: 13 May 2021 | Accepted: 30 July 2021 | Published: 08 September 2021
Copyright:  ©2022  The Author(s). Published by MRE Press.
This is an open access article under the CC BY 4.0 license (https://creativecommons.org/licenses/by/4.0/).

Collapse table of contents

Abstract

Myocardial infarction is a serious representation of cardiovescular disease, MicroRNAs play a role in modifying I/R injury and myocardial infarct remodeling. The present study therefore examined the potential role of miR-187 in cardiac I/R injury and its underlying mechanisms. miR-187 was inhibited or overexpressed in cardiomyocytes H/R models by pretreatment with miR-187 mimic or inhibitor to confirm the function of miR-187 in H/R. DYRK2 was inhibited or overexpressed in cardiomyocytes H/R models by pretreatment with DYRK2 inhibitor. A myocardium I/R mouse model was established. Circulating levels of miR-187 or DYRK2 was detected by quantitative realtime PCR and protein expression was detected by western blotting. The cell viability in all groups was determined by MTT assay and the apoptosis ratio was detected by flow cytometry after staining with Annexin V-FITC. The effect of miR-187 on cellular ROS generation was examined by DCFH-DA. The level of lipid peroxidation and SOD expression were determined by MDA and SOD assay. The findings indicated that miR-187 may be a possible regulator in the protective effect of H/R-induced cardiomyocyte apoptosis, cellular oxidative stress and leaded to DYRK2 suppression at a posttranscriptional level. Moreover, the improvement of miR-187 on H/R-induced cardiomyocyte injury contributed to the obstruction of DYRK2 expression. In addition, these results identified DYRK2 as the functional downstream target of miR-187 regulated myocardial infarction and oxidative stress.These present work provided the first insight into the function of miR-187 in successfully protect cardiomyocyte both in vivo and in vitro, and such a protective effect were mediated through the regulation of DYRK2 expression.

Keywords:miR-187;DYRK2;Cardiomyocyte;Myocardial infarction;Oxidative stress
PDF(1.11 MB)|EndNote (RIS)|BibTeX|RefMan|RefWorks

Cite this article

Fen Zhu, Zhili Yu, Dongsheng Li. miR-187 modulates cardiomyocyte apoptosis and oxidative stress in myocardial infarction mice via negatively regulating DYRK2. Signa Vitae. 2021; 17(5): 142-150. doi: 10.22514/sv.2021.137

1. Introduction

Myocardial infarction is a serious representation of cardiovescular disease that refers to a series of symptoms such as acute occlusion of the coronary arteries [1]. The mechanism of myocardial infarction remodeling leading to heart failure is complex, mostly related to the disordering of an assailable atherosclerotic plaque [2]. In addition, the early diagnosis of myocardial infarction depends on biomarker corroboration of myocyte apoptosis [3] and either electrocardiographic (ECG) criteria of ischemia or infarction [4]. The ECG signal is a useful technique, which can be used to identify cardiac irregularity. However, the process of choosing a set of optimal characteristic to categorize normal and myocardial infarction ECG signals is difficult and can be misinterpreted. The most effective therapeutic intervention of acute myocardial infarction is opportune myocardial reperfusion to rescue the ischemic myocardium [5]. However, ischemia–reperfusion (I/R) injury is an unpredictable complication of cardiovascular surgeries, which can cause injury to the cardiomyocytes. The major mechanisms of I/R contribute to cardiomyocyte injury caused by the overexpression of proinflammatory cytokines by immunological cells [6], reactive oxygen species (ROS) generation [7], Ca2+ overload [8], and apoptosis [9]. Understanding the processes of I/R injury is indispensable to search therapeutic quantifies that can help attenuate the myocardial infarct size.

MicroRNAs play a role in modifying I/R injury and myocardial infarct remodeling. For example, the overexpression of miRNA-1 prevents hypertrophy [10], and miRNA-221, -150, and -206 were reported to have protect effects in in vitro models of I/R [11, 12]. Previous study has reported that miR-187-3p was found to play critical roles in regulating central nervous system disorders [13], and miR-187 was reported to be involved in the important pathogenesis process of I/R-induced ischemic acute renal failure [14]. Dual specificity tyrosine phosphorylation regulated kinase 2 (DYRK2) is a member of the CMGC family (including cyclin-dependent kinases, mitogen-activated protein kinases, glycogen synthase kinases and CDK-like kinases) of protein kinases [15]. It directly interacts with p53 to promote cell apoptosis [16]. However, whether DYRK2 plays a role in the apoptosis of myocardial cells caused by I/R injury remains to be elucidated. Given this string of evidence, the present study therefore examined the potential role of miR-187 in cardiac I/R injury and its underlying mechanisms.

2. Methods

2.1 Cell culture

The primary cultures of cardiomyocytes were obtained from age-matched adult mouse (6–10 weeks old). The hearts from the adult mouse have removed aseptically and ventricle tissues were cut into small pieces and trypsinized at 37 ℃ for 10 min, and this process was repeated 4 times. The cell suspension was centrifuged at 2000 rpm for 5 min and resuspended in the medium for 3 hours. Then the non-adherent cardiomyocytes were removed. The cells maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% FBS and seeded 1 × 105 cells per well into six-well plates at 37 ∘C. The miR-187 mimic, miR-187 inhibitor, shDYRK2 and each negative control oligonucleotides were transfected into cardiomyocytes to overexpression or inhibition the miR-187 or DYRK2 expression levels by using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). After the transfection, the cells were cultured in 3 h of reoxygenation after hypoxia for 4 h (H/R).

2.2 Animals in myocardial ischemia-reperfusion model

Adult male C57BL/6 J mice (weighing 25 ± 3 g) were supplied by Shanghai Experimental Animal Center (Shanghai, China). All animals were housed under a temperature-controlled room with a 12-hour dark-light cycle. All animal experimental procedures were approved by the Ethics Committee of Wuhan Third Hospital & Tongren Hospital of Wuhan University and followed the US National Institutes of Health Guidelines for the Care and Use of Laboratory Animals [17]. To mimic acute myocardial infarction and determine the potential role of miR-187 in I/R-induced cardiac injury, the animals were randomly divided into four groups (n = 10): Sham, I/R, I/R + NC agomir, and I/R + miR-187 agomir. The mice in agomir groups were injected through tail vein with NC agomir or miR-187 agomir (5 nmol/g/day) for 3 consecutive days. After the three days, the mice were anesthetized with intraperitoneally 2% of the urethane, the I/R model was performed via treated with ischemia for 30 min and reperfusion for 24 hours as described [18]. After sacrificed, the heart samples were promptly removed and the blood were collected. The heart tissues were cut into 5 transverse slices of equal thickness (2 mm) [19]. The sections were counterstained with 2,3,5-triphenyltetrazolium chloride (TTC) solution for 15 min and fix with 4% neutral paraformaldehyde. Viable myocardium was red, whereas the infarct area was white. The percentage of infarcted scar length/LV circumferential length analyzed with Image-Pro 6.0 (Media Cybernetics, Silver Spring, MD, USA) for each section.

2.3 Western blot analysis

The protein expression of DYRK2 and β-actin was detected by Western blot analysis as previously studies [20]. The antibodies against DYRK2 and β-actin were purchased from Cell Signaling Technology (1 : 5000 dilution; MA, USA). The chemiluminescence system was used for visualized and quantify the protein bands by Image J software (version 1.51, Wayen Rasband, US National Institutes of Health, USA).

2.4 Dual luciferase reporter gene assay

To investigated whether DYRK2 is a downstream of miR-187, the binding sites of miR-187 and DYRK2 were forecasted by DianaTools. miR-187 mimic, inhibitor, and negative control constructs were purchased from GenePharma (Shanghai, China). pGL3 luciferase reporter gene vector (Promega, Madison, WI, USA) loaded with wild type (WT)- DYRK2 or Mutant (mut)- DYRK2 were co-transfected with 200 ng of miR-187 mimic, miR-187 inhibitor or negative control (NC) into HEK293T cells. The luciferase activity was assayed with the dual luciferase reporter assay system (Promega, WI, USA) according to the manufacturer’s instructions.

2.5 Quantitative real-time PCR

Total RNA from cardiomyocytes after different treatments or heart tissue was extracted using TRIZOL reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocols. A total RNA was reversed by using universal cDNA synthesis and SYBR Green Master Mix kits incorporation on Roche Light- Cycler480 Real Time PCR system (Roche, Germany). The expression of miR-187 was normalized to U6 with the following primers:

miR-187:

Forward (5′-3′): TCGTGTCTTGTGTTGCAGC;

Reverse (5′-3′): GTGCAGGGTCCGAGGT;

U6:

Forward (5′-3′): TCCTCCACGACAACCAAAACC;

Reverse (5′-3′): TCTTTTCCCAAAATCCCAGACTC.

2.6 ROS measurement

Cardiomyocytes were seeded in 12-well culture plates at a density of 1 × 105 cells/mL and then exposured under H/R condition. The cellular ROS generation was detected by Dichlorofluorescein dye (DCFH-DA) then measured the ROS expression according to the previously reported [21]. The samples were measured by fluorescence microscopy (Olympus, Tokyo, Japan).

2.7 Flow cytometry

Cardiomyocytes were detached with trypsin and 1 × 106/mL cells were harvested in binding buffer. The apoptosis ratio of cardiomyocytes were analyzed using the Annexin V-FITC Apoptosis Detection Kit (Thermo, Pittsburgh, PA, USA) following the manufacturer’s instructions. Then the flow cytometry (FACScan, BD Biosciences, San Diego, CA, USA) was used to measuring the apoptotic ratio of cardiomyocytes.

2.8 MTT

Cardiomyocytes were plated in a 96-well culture plate. According to the manufacturer’s instructions, 3-(4,5-Dimethylthiazol2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay [22] (Abcam, Cambridge, UK) were used to detect cardiomyocytes viability in the different treatment groups.

2.9 Measurement the level of LDH, SOD and MDA

The levels of Lactate dehydrogenase (LDH) (Thermo, Pittsburgh, PA, USA), Superoxide Dismutase (SOD) (Thermo, Pittsburgh, PA, USA) and Malondialdehyde (MDA) (ab118970, Abcam, Cambridge, MA, USA) from culture medium, serum and heart tissue were analyzed by the commercial kits according to the manufacturer’s instructions.

2.10 Statistical analysis

All data were expressed as the mean ± SD and analyzed using Statistical Product and Service Solutions (SPSS) 19.0 (SPSS Inc., Chicago, IL, USA) software package. The differences between groups were performed with one-way ANOVA. Statistical significance was considered to be p-value < 0.05.

3. Results

3.1 miR-187 attenuates the H/R-induced cardiomyocyte apoptosis

To investigated the protective effect of miR-187 on I/R-induced cellular apoptosis, miR-187 mimic or miR-187 inhibitor vectors were transfected into cardiomyocytes before H/R treatment. The cell viability in all groups was determined by MTT assay. As shown in Fig. 1A, the cell viability of cardiomyocytes showed a strongly positive association with the miR-187 level after H/R exposure. To assess the effect of miR-187 expression level on H/R-induced cardiomyocyte apoptosis, the cell apoptosis ratio was detected by flow cytometry after staining with Annexin V-FITC. The apoptotic positive cells were extremely reduced in the miR-187 mimic transfected group compared with NC or miR-187 inhibitor group (Fig. 1B). The apoptotic ratio in the H/R + miR-187 inhibitor group was remarkably higher than that in other groups (Fig. 1B). The results indicated that miR-187 may be a potential regulator in the protective effect of H/R-induced cardiomyocyte apoptosis.

Upregulation of miR-187 is involved in H/R-induced cardiomyocyte 
injury. (A) MTT assay was used to detect the cell viability of each group. (B) 
Cardiomyocyte apoptosis was assessed using flow cytometry methods. *** p&lt; 0.001 vs. Control or H/R + miR-NC or H/R + NC inh. ** p &lt; 0.005 
vs. H/R + miR-NC. * p &lt; 0.05 vs. H/R + NC inh. Data are expressed as 
mean ± SD; n = 10.

Fig. 1.Upregulation of miR-187 is involved in H/R-induced cardiomyocyte injury. (A) MTT assay was used to detect the cell viability of each group. (B) Cardiomyocyte apoptosis was assessed using flow cytometry methods. *** p< 0.001 vs. Control or H/R + miR-NC or H/R + NC inh. ** p < 0.005 vs. H/R + miR-NC. * p < 0.05 vs. H/R + NC inh. Data are expressed as mean ± SD; n = 10.

3.2 Overexpression of miR-187 inhibits H/R-induced oxidative stress in cardiomyocyte

To further characterize the functional importance of miR-187 in H/R-induced cardiomyocyte injury, the effect of miR-187 on cellular ROS generation was examined by DCFH-DA. The overexpression of miR-187 efficiently attenuated the ROS production induced by H/R treatment (Fig. 2A). Conversely, the ROS expression levels were significantly increased in the H/R + miR-187 inhibitor group (Fig. 2A). Thereafter, the level of lipid peroxidation and SOD expression were determined by MDA and SOD assay. The inhibition of miR-187 had inverse effects on SOD production and lipid peroxidation in cardiomyocytes, including increased intracellular MDA levels, and attenuated SOD expression (Fig. 2B and C). In addition, the miR-187 mimic group showed reduced MDA levels but increased SOD production (Fig. 2B and C). Taken together, these results suggest that miR-187 participates in the regulation of H/R-induced cellular oxidative stress in cardiomyocytes.

Overexpression of miR-187 reversed the oxidative stress induced 
by H/R in cardiomyocyte. (A) Intracellular ROS generation was measured by 
DCFH-DA. (B) Detection of MDA expression level. (C) Detection of SOD expression 
level. *** p &lt; 0.001 vs. Control or H/R + miR-NC or H/R + NC inh. ** 
p &lt; 0.005 vs. H/R + miR-NC or H/R + NC inh. Data are expressed as mean 
± SD; n = 10.

Fig. 2.Overexpression of miR-187 reversed the oxidative stress induced by H/R in cardiomyocyte. (A) Intracellular ROS generation was measured by DCFH-DA. (B) Detection of MDA expression level. (C) Detection of SOD expression level. *** p < 0.001 vs. Control or H/R + miR-NC or H/R + NC inh. ** p < 0.005 vs. H/R + miR-NC or H/R + NC inh. Data are expressed as mean ± SD; n = 10.

3.3 miR-187 functions as an DYRK2 regulator

To predict the interaction networks between miR-187 and its target genes, TargetScan (http://www.targetscan.org) was used and indicated that the DYRK2 gene constitutes an miR-187-binding domain on its 3′UTR (Fig. 3A). The DYRK2-wt or DYRK2-mut vector and miR-187 mimic, miR-187 inhibitor, or their negative control (NC) were cloned into luciferase reporter plasmids to verify whether miR-187 could directly target DYRK2 mRNA. Dual-luciferase reporter assays showed that the luciferase activity of DYRK2-wt was significantly decreased in cardiomyocytes transfected with miR-187 mimic and obviously enhanced in the miR-187 inhibitor group (Fig. 3B). However, no substantial difference was observed in the DYRK2-mut group. To confirm the relationship between miR-187 and DYRK2, the protein expression after H/R exposure was determined by Western blot. Fig. 3C shows that H/R induction could increase the expression of DYRK2, and co-treatment with miR-187 mimic could remarkably inhibit the expression of DYRK2; however, miR-187 inhibition reversed the effects. Therefore, these results suggest that DYRK2 is the effective target gene of miR-187.

miR-187 directly targets DYRK2. (A) Position of the miR-187 
target site in 3’-UTR of DYRK2 mRNA predicted by TargetScan. (B) Effect of 
miR-187 on DYRK2 expression by luciferase reporter assay. Cardiomyocytes were 
co-transfected with DYRK2-wt or DYRK2-mut vector and miR-187 mimic, miR-187 
inhibitor or their negative control (NC). (C) DYRK2 protein was examined by 
Western blot analysis. *** p &lt; 0.001 vs. Control or H/R + miR-NC or 
H/R + NC inh. Data are expressed as mean ± SD; n = 10.

Fig. 3.miR-187 directly targets DYRK2. (A) Position of the miR-187 target site in 3’-UTR of DYRK2 mRNA predicted by TargetScan. (B) Effect of miR-187 on DYRK2 expression by luciferase reporter assay. Cardiomyocytes were co-transfected with DYRK2-wt or DYRK2-mut vector and miR-187 mimic, miR-187 inhibitor or their negative control (NC). (C) DYRK2 protein was examined by Western blot analysis. *** p < 0.001 vs. Control or H/R + miR-NC or H/R + NC inh. Data are expressed as mean ± SD; n = 10.

3.4 Knockdown DYRK2 reverses the effect of oxidative stress and apoptosis in cardiomyocyte induced by H/R

To examine whether the expression of DYRK2 influenced cell viability, two different shDYRK2 were transfected into cardiomyocytes before undergoing H/R, and MTT assay and Annexin V-FITC staining were performed. Fig. 4A shows that the expression levels of DYRK2 were clearly suppressed in the two shDYRK2 groups based on Western blot compared with the control groups (shNC). The results from cell viability and apoptosis detections showed that the two shDYRK2 had similar protective efficacy to miR-187 mimics. The cell viability was higher in H/R + shDYRK2 than in H/R only condition. Moreover, the numbers of apoptotic cells were partially decreased in H/R + shDYRK2 than in H/R alone (Fig. 4B and C). Then, cellular oxidative stress was assessed to investigate whether DYRK2 is involved in H/R-induced injury. Compared with the H/R + shNC or H/R group, DCFH-DA staining demonstrated that shDYRK2 alleviated H/R-induced ROS generation. Furthermore, shDYRK2 attenuated H/R-induced oxidative stress as shown by MDA and SOD assay. shDYRK2 had protective effects on SOD production and lipid peroxidation in cardiomyocytes, including suppressing intracellular MDA levels and enhancing SOD expression (Fig. 4D and E). These results indicated that the enhancement of miR-187 on H/R-induced cardiomyocyte injury contributed to the obstruction of DYRK2 expression.

Alteration of DYRK2 expression reversed cardiomyocyte injury 
induced by H/R. Cardiomyocytes were transfected with shNC, shDYRK2#1 or 
shDYRK2#2. (A) DYRK2 protein was examined by Western blot analysis. (B) MTT 
assay was used to detect the cell viability of each group. (C) Cardiomyocyte 
apoptosis was assessed using flow cytometry methods. (D) Intracellular ROS 
generation was measured by DCFH-DA. (E) Detection of MDA expression level. (F) 
Detection of SOD expression level. *** p &lt; 0.001 vs. Control or shNC 
or H/R + shNC. ** p &lt; 0.005 vs. shNC or or H/R + shNC. * p&lt; 0.05 vs. H/R + shNC. Data are expressed as mean ± SD.

Fig. 4.Alteration of DYRK2 expression reversed cardiomyocyte injury induced by H/R. Cardiomyocytes were transfected with shNC, shDYRK2#1 or shDYRK2#2. (A) DYRK2 protein was examined by Western blot analysis. (B) MTT assay was used to detect the cell viability of each group. (C) Cardiomyocyte apoptosis was assessed using flow cytometry methods. (D) Intracellular ROS generation was measured by DCFH-DA. (E) Detection of MDA expression level. (F) Detection of SOD expression level. *** p < 0.001 vs. Control or shNC or H/R + shNC. ** p < 0.005 vs. shNC or or H/R + shNC. * p< 0.05 vs. H/R + shNC. Data are expressed as mean ± SD.

3.5 Overexpression of miR-187 attenuates cardiac injury induced by I/R in vivo

To further determine whether miR-187 is involved in the pathogenesis of myocardial infarction in the animal model, a myocardium I/R mouse model was established using miR-187 treated mice. In this animal model, miR-187 was elevated after miR-187 agomir treatment (Fig. 5E), and the expression levels of DYRK2 were significantly decreased in the miR-187 overexpression group (Fig. 5F). Fig. 5A shows that the infarction size of I/R mice increased remarkably, and the infarction size tended to decrease after the miR-187 overexpression treatment. Furthermore, the overexpression of miR-187 by agomir delivery in vivo (Fig. 5E) resulted in a reduction in cardiac-specific enzymes LDH (Fig. 5B) and MDA (Fig. 5C). In addition, the oxidative stress of cardiomyocytes was determined. Compared with the I/R or I/R + NC group, miR-187 overexpression remarkably triggered SOD production in the I/R condition (Fig. 5D). These results indicate that miR-187 regulated myocardial infarction and oxidative stress by targeting DYRK2.

Overexpression of miR-187 suppressed ischemia/reperfusion 
induced myocardial infarct in vivo. The mice were received the 
over-expression vectors of miR-187 agomir or NC agomir. (A) Representative 
crosssectional images of I/R (ischemia 30 min, reperfusion 24 h) heart with TTC 
n = 10. (B) Detection of serum lactate dehydrogenase (LDH) level. (C) Detection 
of MDA expression level. (D) Detection of SOD expression level. (E) The 
expression level of miR-187 in vivo was measured by qRT-PCR. (F) The expression 
of DYRK2 was measured by western blot. *** p &lt; 0.001 vs. Sham or I/R + 
NC agomir. Data are expressed as mean ± SD.

Fig. 5.Overexpression of miR-187 suppressed ischemia/reperfusion induced myocardial infarct in vivo. The mice were received the over-expression vectors of miR-187 agomir or NC agomir. (A) Representative crosssectional images of I/R (ischemia 30 min, reperfusion 24 h) heart with TTC n = 10. (B) Detection of serum lactate dehydrogenase (LDH) level. (C) Detection of MDA expression level. (D) Detection of SOD expression level. (E) The expression level of miR-187 in vivo was measured by qRT-PCR. (F) The expression of DYRK2 was measured by western blot. *** p < 0.001 vs. Sham or I/R + NC agomir. Data are expressed as mean ± SD.

4. Discussion

The cardiovascular system is especially easily affected by metabolic disorders and stresses, and several risk factors promote cardiovascular dysfunction via the nerve and endocrine systems, leading to cardiovascular system disorders such as myocardial infarction, atherosclerosis, and ischemic heart diseases, which are characterized by inflammation, cardiomyocyte apoptosis, and heart failure [23]. Myocardial infarction remains one of the risk factors for death. It is usually associated with a deficit in cardiac energy metabolism and increased oxidative stress. Thus, the molecular mechanisms of myocardial infarction should be elucidated, and potential therapeutic targets for heart failure should be discovered. Recently, miRNAs have been demonstrated to play a critical role in myocardial injuries and cardiac function regulation [24]. The expression of miR-187 has been shown to be upregulated in multiple types of disease, including breast cancer, prostate cancer, cervical cancer, and type 2 diabetes [25]. miR-187 has also been reported to play essential roles in ischemic acute renal failure. However, no studies have reported the protective effects of miR-187 against I/R-induced cellular apoptosis in the cardiovascular system. To investigate the key roles of miR-187 in myocardial infarction, an H/R cardiomyocyte model was established, and miR-187 mimics and inhibitor were transfected into cardiomyocytes before H/R treatment. This study investigated the function and possible therapeutic applications of miR-187 in regulating the biological characteristics of cardiomyocytes. The first significant finding was that miR-187 may be a potential regulator in the protective effect of H/R-induced cardiomyocyte apoptosis. This finding is consistent with previous studies, wherein miR-187 was significantly decreased (~2.77-fold) in patients with coronary artery disease [26]. The present study found that the overexpression of miR-187 inhibits H/R-induced oxidative stress in cardiomyocytes. However, the underlying protective mechanism of miR-187 mimics still remains unclear. To determine the molecular mechanisms involved in miR-187-mediated pathogenic properties, DYRK2 was used for bioinformatics analysis as it is an effective target of miR-187. DYRK2 is known as a critical regulator of cell cycle and apoptosis. In previous studies, DYRK2 was used to regulate the G1/S transition and epithelial–mesenchymal transition in tumor cells [27]. DYRK2 is predominantly localized in the cytoplasm and phosphorylation at Thr33 and Ser369 by ataxia telangiectasia-mutated induces the nuclear localization and involved in DNA repair process, finally, induce cellular apoptosis [28]. The present work demonstrates that DYRK2 knockdown reverses the effect of oxidative stress and apoptosis in cardiomyocytes induced by H/R. This result supports the notion that the improvement of miR-187 on H/R-induced cardiomyocyte injury contributes to the obstruction of DYRK2 expression. Moreover, in the animal model, miR-187 overexpression remarkably triggered SOD production in I/R condition. Thus, these results demonstrate that miR-187 directly targets DYRK2 and attenuates I/R-induced myocardial oxidative damage.

5. Conclusions

In conclusion, these present work provided the first insight into the function of miR-187 in successfully protect cardiomyocyte both in vivo and in vitro, and such a protective effect were mediated through the regulation of DYRK2 expression.

Author contributions

FZ designed the study, supervised the data collection, ZY analyzed the data, interpreted the data, DL prepare the manuscript for publication and reviewed the draft of the manuscript. All authors have read and approved the manuscript.

Ethics approval and consent to participate

Ethical approval was obtained from the Ethics Committee of Wuhan Third Hospital & Tongren Hospital of Wuhan University (Approval No. SY2019-017).

Acknowledgment

Thanks to all the peer reviewers for their opinions and suggestions.

Funding

This research received no external funding.

Conflict of interest

The authors declare no conflict of interest.

References

Wang ZH, Pan JH, Ma XP, Xu XY, Yu WH, Fu WJ et al. Cardioprotective effect of Shenxiong glucose injection on acute myocardial infarction in rats via reduction in myocardial intracellular calcium ion overload. Tropical Journal of Pharmaceutical Research. 2017; 16: 1097–1104.

[Google Scholar]

Sedding DG, Boyle EC, Demandt JAF, Sluimer JC, Dutzmann J, Haverich A, et al. Vasa vasorum angiogenesis: key player in the initiation and progression of atherosclerosis and potential target for the treatment of cardiovascular disease. Frontiers in Immunology. 2018; 9: 706.

[Google Scholar]

Maznyczka A, Kaier T, Marber M. Troponins and other biomarkers in the early diagnosis of acute myocardial infarction. Postgraduate Medical Journal. 2015; 91: 322–330.

[Google Scholar]

Zimetbaum PJ, Josephson ME. Use of the electrocardiogram in acute myocardial infarction. New England Journal of Medicine. 2003; 348: 933–940.

[Google Scholar]

Steg PG, James SK, Atar D, Badano LP, Blömstrom-Lundqvist C, Borger MA, et al. ESC Guidelines for the management of acute myocardial infarction in patients presenting with ST-segment elevation: The Task Force on the management of ST-segment elevation acute myocardial infarction of the European Society of Cardiology (ESC). European Heart Journal. 2012; 33: 2569–2619.

[Google Scholar]

Nishikawa H, Taniguchi Y, Matsumoto T, Arima N, Masaki M, Shimamura Y, et al. Knockout of the interleukin-36 receptor protects against renal ischemia-reperfusion injury by reduction of proinflammatory cytokines. Kidney International. 2018; 93: 599–614.

[Google Scholar]

Bagheri F, Khori V, Alizadeh AM, Khalighfard S, Khodayari S, Khodayari H. Reactive oxygen species-mediated cardiac-reperfusion injury: Mechanisms and therapies. Life Sciences. 2016; 165: 43–55.

[Google Scholar]

Chang JC, Lien CF, Lee WS, Chang HR, Hsu YC, Luo YP, et al. Intermittent hypoxia prevents myocardial mitochondrial Ca2+ overload and cell death during ischemia/reperfusion: the role of reactive oxygen species. Cells. 2019; 8: 564.

[Google Scholar]

Xue J, Yan X, Yang Y, Chen M, Wu L, Gou Z, et al. Connexin 43 dephosphorylation contributes to arrhythmias and cardiomyocyte apoptosis in ischemia/reperfusion hearts. Basic Research in Cardiology. 2019; 114: 40.

[Google Scholar]

Diniz GP, Lino CA, Moreno CR, Senger N, Barreto-Chaves MLM. MicroRNA-1 overexpression blunts cardiomyocyte hypertrophy elicited by thyroid hormone. Journal of Cellular Physiology. 2017; 232: 3360–3368.

[Google Scholar]

Chen Z, Wang H, Xia Y, Yan F, Lu Y. Therapeutic Potential of Mesenchymal Cell-Derived miRNA-150-5p-Expressing Exosomes in Rheumatoid Arthritis Mediated by the Modulation of MMP14 and VEGF. Journal of Immunology. 2018; 201: 2472–2482.

[Google Scholar]

Zhai C, Qian Q, Tang G, Han B, Hu H, Yin D, et al. MicroRNA-206 Protects against Myocardial Ischaemia-Reperfusion Injury in Rats by Targeting Gadd45β. Molecules and Cells. 2017; 40: 916–924.

[Google Scholar]

Zhao C, Zhou B, Cao J, Zhang Y, Li W, Wang M, et al. miR-187-3p participates in contextual fear memory formation through modulating SATB2 expression in the hippocampus. NeuroReport. 2020; 31: 909–917.

[Google Scholar]

Fay MJ, Alt LAC, Ryba D, Salamah R, Peach R, Papaeliou A, et al. Cadmium Nephrotoxicity is Associated with Altered MicroRNA Expression in the Rat Renal Cortex. Toxics. 2018; 6: 16.

[Google Scholar]

Yan H, Hu K, Wu W, Li Y, Tian H, Chu Z, et al. Low Expression of DYRK2 (Dual Specificity Tyrosine Phosphorylation Regulated Kinase 2) Correlates with Poor Prognosis in Colorectal Cancer. PLoS ONE. 2016; 11: e0159954.

[Google Scholar]

Yoshida S, Yoshida K. Multiple functions of DYRK2 in cancer and tissue development. FEBS Letters. 2019; 593: 2953–2965.

[Google Scholar]

National Research Council (US) Committee for the Update of the Guide for the Care and Use of Laboratory Animals. Guide for the Care and Use of Laboratory Animals. 8th edition. Washington (DC): National Academies Press. 2011.

[Google Scholar]

Schumer M, Colombel MC, Sawczuk IS, Gobé G, Connor J, O’Toole KM, et al. Morphologic, biochemical, and molecular evidence of apoptosis during the reperfusion phase after brief periods of renal ischemia. American Journal of Pathology. 1992; 140: 831–838.

[Google Scholar]

Huang G, Hao F, Hu X. Downregulation of microRNA‐155 stimulates sevoflurane‐mediated cardioprotection against myocardial ischemia/reperfusion injury by binding to SIRT1 in mice. Journal of Cellular Biochemistry. 2019; 120: 15494–15505.

[Google Scholar]

MacPhee DJ. Methodological considerations for improving Western blot analysis. Journal of Pharmacological and Toxicological Methods. 2010; 61: 171–177.

[Google Scholar]

Aranda A, Sequedo L, Tolosa L, Quintas G, Burello E, Castell JV, et al. Dichloro-dihydro-fluorescein diacetate (DCFH-DA) assay: a quantitative method for oxidative stress assessment of nanoparticle-treated cells. Toxicology in Vitro. 2013; 27: 954–963.

[Google Scholar]

Alamer A, Ali D, Alarifi S, Alkahtane A, AL-Zharani M, Abdel-Daim MM, et al. Bismuth oxide nanoparticles induce oxidative stress and apoptosis in human breast cancer cells. Environmental Science and Pollution Research. 2021; 28: 7379–7389.

[Google Scholar]

Van Linthout S, Tschöpe C. Inflammation—Cause or Consequence of Heart Failure or both? Current Heart Failure Reports. 2017; 14: 251–265.

[Google Scholar]

Sun T, Li M, Li P, Cao J. MicroRNAs in Cardiac Autophagy: Small Molecules and Big Role. Cells. 2018; 7: 104.

[Google Scholar]

Sun C, Li S, Yang C, Xi Y, Wang L, Zhang F, et al. MicroRNA-187-3p mitigates non-small cell lung cancer (NSCLC) development through down-regulation of BCL6. Biochemical and Biophysical Research Communications. 2016; 471: 82–88.

[Google Scholar]

Weber M, Baker MB, Patel RS, Quyyumi AA, Bao G, Searles CD. MicroRNA Expression Profile in CAD Patients and the Impact of ACEI/ARB. Cardiology Research and Practice. 2011; 2011: 532915.

[Google Scholar]

Nihira NT, Yoshida K. Engagement of DYRK2 in proper control for cell division. Cell Cycle. 2015; 14: 802–807.

[Google Scholar]

Yogosawa S, Yoshida K. Tumor suppressive role for kinases phosphorylating p53 in DNA damage-induced apoptosis. Cancer science. 2018; 109: 3376–3382.

[Google Scholar]