miR-187 modulates cardiomyocyte apoptosis and oxidative stress in myocardial infarction mice via negatively regulating DYRK2

2.1 Cell culture

The primary cultures of cardiomyocytes were obtained from age-matched adult mouse (6–10 weeks old). The hearts from the adult mouse have removed aseptically and ventricle tissues were cut into small pieces and trypsinized at 37 ℃ for 10 min, and this process was repeated 4 times. The cell suspension was centrifuged at 2000 rpm for 5 min and resuspended in the medium for 3 hours. Then the non-adherent cardiomyocytes were removed. The cells maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% FBS and seeded 1 $\times$ 10${}^5$ cells per well into six-well plates at 37 ${}^{\circ }$C. The miR-187 mimic, miR-187 inhibitor, shDYRK2 and each negative control oligonucleotides were transfected into cardiomyocytes to overexpression or inhibition the miR-187 or DYRK2 expression levels by using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). After the transfection, the cells were cultured in 3 h of reoxygenation after hypoxia for 4 h (H/R).

2.2 Animals in myocardial ischemia-reperfusion model

Adult male C57BL/6 J mice (weighing 25 $\pm$ 3 g) were supplied by Shanghai Experimental Animal Center (Shanghai, China). All animals were housed under a temperature-controlled room with a 12-hour dark-light cycle. All animal experimental procedures were approved by the Ethics Committee of Wuhan Third Hospital & Tongren Hospital of Wuhan University and followed the US National Institutes of Health Guidelines for the Care and Use of Laboratory Animals [17]. To mimic acute myocardial infarction and determine the potential role of miR-187 in I/R-induced cardiac injury, the animals were randomly divided into four groups (n = 10): Sham, I/R, I/R + NC agomir, and I/R + miR-187 agomir. The mice in agomir groups were injected through tail vein with NC agomir or miR-187 agomir (5 nmol/g/day) for 3 consecutive days. After the three days, the mice were anesthetized with intraperitoneally 2% of the urethane, the I/R model was performed via treated with ischemia for 30 min and reperfusion for 24 hours as described [18]. After sacrificed, the heart samples were promptly removed and the blood were collected. The heart tissues were cut into 5 transverse slices of equal thickness (2 mm) [19]. The sections were counterstained with 2,3,5-triphenyltetrazolium chloride (TTC) solution for 15 min and fix with 4% neutral paraformaldehyde. Viable myocardium was red, whereas the infarct area was white. The percentage of infarcted scar length/LV circumferential length analyzed with Image-Pro 6.0 (Media Cybernetics, Silver Spring, MD, USA) for each section.

2.3 Western blot analysis

The protein expression of DYRK2 and $\beta$-actin was detected by Western blot analysis as previously studies [20]. The antibodies against DYRK2 and $\beta$-actin were purchased from Cell Signaling Technology (1 : 5000 dilution; MA, USA). The chemiluminescence system was used for visualized and quantify the protein bands by Image J software (version 1.51, Wayen Rasband, US National Institutes of Health, USA).

2.4 Dual luciferase reporter gene assay

To investigated whether DYRK2 is a downstream of miR-187, the binding sites of miR-187 and DYRK2 were forecasted by DianaTools. miR-187 mimic, inhibitor, and negative control constructs were purchased from GenePharma (Shanghai, China). pGL3 luciferase reporter gene vector (Promega, Madison, WI, USA) loaded with wild type (WT)- DYRK2 or Mutant (mut)- DYRK2 were co-transfected with 200 ng of miR-187 mimic, miR-187 inhibitor or negative control (NC) into HEK293T cells. The luciferase activity was assayed with the dual luciferase reporter assay system (Promega, WI, USA) according to the manufacturer’s instructions.

2.5 Quantitative real-time PCR

Total RNA from cardiomyocytes after different treatments or heart tissue was extracted using TRIZOL reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocols. A total RNA was reversed by using universal cDNA synthesis and SYBR Green Master Mix kits incorporation on Roche Light- Cycler480 Real Time PCR system (Roche, Germany). The expression of miR-187 was normalized to U6 with the following primers:

miR-187:

Forward (5${}^{\mathrm{\prime }}$-3${}^{\mathrm{\prime }}$): TCGTGTCTTGTGTTGCAGC;

Reverse (5${}^{\mathrm{\prime }}$-3$\mathrm{\prime }$): GTGCAGGGTCCGAGGT;

U6:

Forward (5${}^{\mathrm{\prime }}$-3${}^{\mathrm{\prime }}$): TCCTCCACGACAACCAAAACC;

Reverse (5${}^{\mathrm{\prime }}$-3${}^{\mathrm{\prime }}$): TCTTTTCCCAAAATCCCAGACTC.

2.6 ROS measurement

Cardiomyocytes were seeded in 12-well culture plates at a density of 1 $\times$ 10${}^5$ cells/mL and then exposured under H/R condition. The cellular ROS generation was detected by Dichlorofluorescein dye (DCFH-DA) then measured the ROS expression according to the previously reported [21]. The samples were measured by fluorescence microscopy (Olympus, Tokyo, Japan).

2.7 Flow cytometry

Cardiomyocytes were detached with trypsin and 1 $\times$ 10${}^6$/mL cells were harvested in binding buffer. The apoptosis ratio of cardiomyocytes were analyzed using the Annexin V-FITC Apoptosis Detection Kit (Thermo, Pittsburgh, PA, USA) following the manufacturer’s instructions. Then the flow cytometry (FACScan, BD Biosciences, San Diego, CA, USA) was used to measuring the apoptotic ratio of cardiomyocytes.

2.8 MTT

Cardiomyocytes were plated in a 96-well culture plate. According to the manufacturer’s instructions, 3-(4,5-Dimethylthiazol2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay [22] (Abcam, Cambridge, UK) were used to detect cardiomyocytes viability in the different treatment groups.

2.9 Measurement the level of LDH, SOD and MDA

The levels of Lactate dehydrogenase (LDH) (Thermo, Pittsburgh, PA, USA), Superoxide Dismutase (SOD) (Thermo, Pittsburgh, PA, USA) and Malondialdehyde (MDA) (ab118970, Abcam, Cambridge, MA, USA) from culture medium, serum and heart tissue were analyzed by the commercial kits according to the manufacturer’s instructions.

2.10 Statistical analysis

All data were expressed as the mean $\pm$ SD and analyzed using Statistical Product and Service Solutions (SPSS) 19.0 (SPSS Inc., Chicago, IL, USA) software package. The differences between groups were performed with one-way ANOVA. Statistical significance was considered to be p-value $<$ 0.05.

3.1 miR-187 attenuates the H/R-induced cardiomyocyte apoptosis

To investigated the protective effect of miR-187 on I/R-induced cellular apoptosis, miR-187 mimic or miR-187 inhibitor vectors were transfected into cardiomyocytes before H/R treatment. The cell viability in all groups was determined by MTT assay. As shown in Fig. 1A, the cell viability of cardiomyocytes showed a strongly positive association with the miR-187 level after H/R exposure. To assess the effect of miR-187 expression level on H/R-induced cardiomyocyte apoptosis, the cell apoptosis ratio was detected by flow cytometry after staining with Annexin V-FITC. The apoptotic positive cells were extremely reduced in the miR-187 mimic transfected group compared with NC or miR-187 inhibitor group (Fig. 1B). The apoptotic ratio in the H/R + miR-187 inhibitor group was remarkably higher than that in other groups (Fig. 1B). The results indicated that miR-187 may be a potential regulator in the protective effect of H/R-induced cardiomyocyte apoptosis.

Fig. 1.Upregulation of miR-187 is involved in H/R-induced cardiomyocyte injury. (A) MTT assay was used to detect the cell viability of each group. (B) Cardiomyocyte apoptosis was assessed using flow cytometry methods. *** p$<$ 0.001 vs. Control or H/R + miR-NC or H/R + NC inh. ** p $<$ 0.005 vs. H/R + miR-NC. * p $<$ 0.05 vs. H/R + NC inh. Data are expressed as mean $\pm$ SD; n = 10.

3.2 Overexpression of miR-187 inhibits H/R-induced oxidative stress in cardiomyocyte

To further characterize the functional importance of miR-187 in H/R-induced cardiomyocyte injury, the effect of miR-187 on cellular ROS generation was examined by DCFH-DA. The overexpression of miR-187 efficiently attenuated the ROS production induced by H/R treatment (Fig. 2A). Conversely, the ROS expression levels were significantly increased in the H/R + miR-187 inhibitor group (Fig. 2A). Thereafter, the level of lipid peroxidation and SOD expression were determined by MDA and SOD assay. The inhibition of miR-187 had inverse effects on SOD production and lipid peroxidation in cardiomyocytes, including increased intracellular MDA levels, and attenuated SOD expression (Fig. 2B and C). In addition, the miR-187 mimic group showed reduced MDA levels but increased SOD production (Fig. 2B and C). Taken together, these results suggest that miR-187 participates in the regulation of H/R-induced cellular oxidative stress in cardiomyocytes.

Fig. 2.Overexpression of miR-187 reversed the oxidative stress induced by H/R in cardiomyocyte. (A) Intracellular ROS generation was measured by DCFH-DA. (B) Detection of MDA expression level. (C) Detection of SOD expression level. *** p $<$ 0.001 vs. Control or H/R + miR-NC or H/R + NC inh. ** p $<$ 0.005 vs. H/R + miR-NC or H/R + NC inh. Data are expressed as mean $\pm$ SD; n = 10.

3.3 miR-187 functions as an DYRK2 regulator

To predict the interaction networks between miR-187 and its target genes, TargetScan (http://www.targetscan.org) was used and indicated that the DYRK2 gene constitutes an miR-187-binding domain on its 3$\mathrm{\prime }$UTR (Fig. 3A). The DYRK2-wt or DYRK2-mut vector and miR-187 mimic, miR-187 inhibitor, or their negative control (NC) were cloned into luciferase reporter plasmids to verify whether miR-187 could directly target DYRK2 mRNA. Dual-luciferase reporter assays showed that the luciferase activity of DYRK2-wt was significantly decreased in cardiomyocytes transfected with miR-187 mimic and obviously enhanced in the miR-187 inhibitor group (Fig. 3B). However, no substantial difference was observed in the DYRK2-mut group. To confirm the relationship between miR-187 and DYRK2, the protein expression after H/R exposure was determined by Western blot. Fig. 3C shows that H/R induction could increase the expression of DYRK2, and co-treatment with miR-187 mimic could remarkably inhibit the expression of DYRK2; however, miR-187 inhibition reversed the effects. Therefore, these results suggest that DYRK2 is the effective target gene of miR-187.

Fig. 3.miR-187 directly targets DYRK2. (A) Position of the miR-187 target site in 3’-UTR of DYRK2 mRNA predicted by TargetScan. (B) Effect of miR-187 on DYRK2 expression by luciferase reporter assay. Cardiomyocytes were co-transfected with DYRK2-wt or DYRK2-mut vector and miR-187 mimic, miR-187 inhibitor or their negative control (NC). (C) DYRK2 protein was examined by Western blot analysis. *** p $<$ 0.001 vs. Control or H/R + miR-NC or H/R + NC inh. Data are expressed as mean $\pm$ SD; n = 10.

3.4 Knockdown DYRK2 reverses the effect of oxidative stress and apoptosis in cardiomyocyte induced by H/R

To examine whether the expression of DYRK2 influenced cell viability, two different shDYRK2 were transfected into cardiomyocytes before undergoing H/R, and MTT assay and Annexin V-FITC staining were performed. Fig. 4A shows that the expression levels of DYRK2 were clearly suppressed in the two shDYRK2 groups based on Western blot compared with the control groups (shNC). The results from cell viability and apoptosis detections showed that the two shDYRK2 had similar protective efficacy to miR-187 mimics. The cell viability was higher in H/R + shDYRK2 than in H/R only condition. Moreover, the numbers of apoptotic cells were partially decreased in H/R + shDYRK2 than in H/R alone (Fig. 4B and C). Then, cellular oxidative stress was assessed to investigate whether DYRK2 is involved in H/R-induced injury. Compared with the H/R + shNC or H/R group, DCFH-DA staining demonstrated that shDYRK2 alleviated H/R-induced ROS generation. Furthermore, shDYRK2 attenuated H/R-induced oxidative stress as shown by MDA and SOD assay. shDYRK2 had protective effects on SOD production and lipid peroxidation in cardiomyocytes, including suppressing intracellular MDA levels and enhancing SOD expression (Fig. 4D and E). These results indicated that the enhancement of miR-187 on H/R-induced cardiomyocyte injury contributed to the obstruction of DYRK2 expression.

Fig. 4.Alteration of DYRK2 expression reversed cardiomyocyte injury induced by H/R. Cardiomyocytes were transfected with shNC, shDYRK2#1 or shDYRK2#2. (A) DYRK2 protein was examined by Western blot analysis. (B) MTT assay was used to detect the cell viability of each group. (C) Cardiomyocyte apoptosis was assessed using flow cytometry methods. (D) Intracellular ROS generation was measured by DCFH-DA. (E) Detection of MDA expression level. (F) Detection of SOD expression level. *** p $<$ 0.001 vs. Control or shNC or H/R + shNC. ** p $<$ 0.005 vs. shNC or or H/R + shNC. * p$<$ 0.05 vs. H/R + shNC. Data are expressed as mean $\pm$ SD.

3.5 Overexpression of miR-187 attenuates cardiac injury induced by I/R in vivo

To further determine whether miR-187 is involved in the pathogenesis of myocardial infarction in the animal model, a myocardium I/R mouse model was established using miR-187 treated mice. In this animal model, miR-187 was elevated after miR-187 agomir treatment (Fig. 5E), and the expression levels of DYRK2 were significantly decreased in the miR-187 overexpression group (Fig. 5F). Fig. 5A shows that the infarction size of I/R mice increased remarkably, and the infarction size tended to decrease after the miR-187 overexpression treatment. Furthermore, the overexpression of miR-187 by agomir delivery in vivo (Fig. 5E) resulted in a reduction in cardiac-specific enzymes LDH (Fig. 5B) and MDA (Fig. 5C). In addition, the oxidative stress of cardiomyocytes was determined. Compared with the I/R or I/R + NC group, miR-187 overexpression remarkably triggered SOD production in the I/R condition (Fig. 5D). These results indicate that miR-187 regulated myocardial infarction and oxidative stress by targeting DYRK2.

Fig. 5.Overexpression of miR-187 suppressed ischemia/reperfusion induced myocardial infarct in vivo. The mice were received the over-expression vectors of miR-187 agomir or NC agomir. (A) Representative crosssectional images of I/R (ischemia 30 min, reperfusion 24 h) heart with TTC n = 10. (B) Detection of serum lactate dehydrogenase (LDH) level. (C) Detection of MDA expression level. (D) Detection of SOD expression level. (E) The expression level of miR-187 in vivo was measured by qRT-PCR. (F) The expression of DYRK2 was measured by western blot. *** p $<$ 0.001 vs. Sham or I/R + NC agomir. Data are expressed as mean $\pm$ SD.