Signa Vitae. 2022; 18(3): 101-110. doi: 10.22514/sv.2022.030
Original Research

The role of genome-scale leukocyte long noncoding RNA in identifying acute aortic dissection

Tongyao Li1,2,†, Yiwu Zhou1,†, Dongze Li1, Zhi Zeng1, Shu Zhang1,*,

1Department of Emergency Medicine, Emergency Medical Laboratory, West China Hospital, Sichuan University, 610041 Chengdu, Sichuan, China

2West China Medical School, West China Hospital, Sichuan University, 610041 Chengdu, Sichuan, China

*Corresponding Author(s):zhangs@wchscu.cn (Shu Zhang)

† These authors contributed equally.

† These authors contributed equally.

History Submitted: 13 November 2021 | Accepted: 21 December 2021 | Published: 08 May 2022
Copyright:  ©2022  The Author(s). Published by MRE Press.
This is an open access article under the CC BY 4.0 license (https://creativecommons.org/licenses/by/4.0/).

Collapse table of contents

Abstract

Acute aortic dissection (AAD) is a disease with intima rupture and explosive inflammatory reaction. In this study, we detected the expression pattern of genome-scale leukocyte long noncoding RNAs (lncRNAs) in patients with AAD and explored the diagnostic efficacy and inflammatory mechanism. The expression levels of lncRNAs and mRNAs in 5 patients with AAD and 5 control cases were detected by microarray technology and were verified in 20 AAD cases and 10 control individuals. A total of 540 up- and 1078 down-regulated lncRNAs were significantly expressed between the two groups. Based on microarray analysis, confirmation through quantitative real-time polymerase chain reaction, and criteria for clinical relevance, three lncRNAs ENST00000430893.1, ENST00000536517.1, and ENST00000593848.1 were identified as potentially important diagnostic lncRNAs of AAD. Receiver operating characteristic curve (ROC curve) analysis showed that the area under curve (AUC) of ENST00000593848.1 was 0.790 (neutrophils, p < 0.05) and 0.725 (monocytes, p < 0.05). The corresponding target gene of ENST00000593848.1 was solute carrier family 8 member A1 (SLC8A1), which encodes a sodium calcium exchanger. Compared with transfection of no-load siRNA group, the Ca2+ levels, interleukin-6 (IL-6) levels, mRNA levels of extracellular regulated kinase (ERK) 1/2, and the activity of P-NF-κB p65 in THP-1 cells were increased after transfection of si-lncRNA (SILNC) (p < 0.05). Together, these results indicate that the three different lncRNAs ENST00000430893.1, ENST00000536517.1, and ENST00000593848.1 may play an anti-inflammatory role in patients with AAD, and ENST00000593848.1 is a promising candidate to further explore as a potential diagnostic and prognostic factor as well as for developing novel therapeutic strategies.

Keywords:Acute aortic dissection;Long non-coding RNA;Diagnosis;Microarray;Anti-inflammation
PDF(4.02 MB)|EndNote (RIS)|BibTeX|RefMan|RefWorks

Cite this article

Tongyao Li, Yiwu Zhou, Dongze Li, Zhi Zeng, Shu Zhang. The role of genome-scale leukocyte long noncoding RNA in identifying acute aortic dissection. Signa Vitae. 2022; 18(3): 101-110. doi: 10.22514/sv.2022.030

1. Introduction

Acute aortic dissection (AAD) refers to the local rupture of the aortic intima under the effect of the artery itself or external force. The arterial blood enters the middle layer of the arterial wall through the tear of the intima, and under the effect of the arterial blood pressure, it is pulled along the longitudinal axis of the artery near or far [1]. AAD shows characteristics of sudden, rapid development, and acute death, and thereby seriously threatens the life of patients [2]. The mortality rate of type A AAD in the early stage is more than 60%, and the rate increases by 1–2% per hour in the first 24 hours after initial presentation [3]. Early diagnosis and effective treatment are key to improving the prognosis of patients with AAD. At present, the diagnosis of AAD depends on computed tomographic angiography (CTA), and its treatment depends on surgery [2]. However, CTA examination is not a routine examination, as it has the disadvantages of limited use and high cost, and there is almost no effective drug treatment to control the progression of AAD. Therefore, exploring the intrinsic pathophysiological mechanism of AAD and thereby identifying and developing new diagnoses and treatment strategies are expected to improve the prognosis of patients [4].

The direct manifestation of AAD is vascular intimal injury, with systemic and serious inflammatory reactions during its occurrence and development [5]. It is reported that the level of plasma leukocyte is significantly related to the prognosis of AAD patients [6, 7]. Inflammatory factors (such as interleukin) secreted by leukocytes can infiltrate the aortic wall, degrade extracellular matrix and elastin, resulting in thinning of the vascular wall, and interact with platelets, tissue factors, and fibrin, which has a decisive impact on vascular disease [8, 9].

Long non-coding RNAs (lncRNAs) is a class of RNA sequences with a nucleotide (nt) length greater than 200 nt. It can regulate the expression of genes through epigenetic, transcriptional process, and post transcriptional regulation, and shows stable expression levels in plasma [10]. Previous studies have reported that lncRNAs are involved in the pathophysiological changes associated with heart failure, atherosclerosis, and cardio cerebrovascular diseases [11, 12, 13, 14, 15], and lncRNAs in leukocytes have shown a good diagnostic efficacy in myocardial infarction [16]. However, the association between lncRNAs in leukocytes and AAD has not been reported. In this study, the expression pattern of lncRNAs in leukocytes of patients with AAD was evaluated, and the diagnostic power and inflammatory pathophysiological mechanism of the lncRNAs were explored.

2. Materials and Methods

2.1 Design and population

From September 1, 2016 to November 30, 2016, 25 AAD patients and 15 healthy volunteers were included in the prospective study. Inclusion criteria were: age ≥18 years, onset time ≤2 weeks, and patients were diagnosed with AAD by CTA. Exclusion criteria were: pregnant women, patients with AAD caused by trauma, and AAD combined with infection or blood system, immune system or cancer and other diseases. There were 5 cases in the AAD group and 5 cases in the healthy group in initial experiments, and further experiments to verify role of differentially expressed lncRNAs were conducted with another independent group comprising of 20 cases in the AAD group and 10 cases in the healthy group.

Experimental groups included blank control group: without any intervention factors; LPS group: Lipopolysaccharide (LPS, 1 μg/mL); target SILNC-2-1 group: transfection of SILNC-2-1 + LPS (1 μg/mL); target SILNC-2-2 group: transfection of SILNC-2-2 + LPS (1 μg/mL); SINC control group: transfection of no-load siRNA + LPS (1 μg/mL).

2.2 Data and collection

Characteristics of patients and healthy volunteers were collected, including age, gender, vital signs, previous disease history, treatment plan, and drug information. The laboratory results of AAD patients and healthy volunteers were recorded, including levels of leukocytes, neutrophils, monocytes, interleukin-6 (IL-6), c-reactive protein (CRP), and D-dimer.

2.3 Collection of leukocytes and subtypes

Peripheral venous blood (6 mL) of AAD patients and healthy volunteers were collected and packed into anticoagulant ethylene diamine tetraacetic acid (EDTA) tubes (Invitrogen, CA, USA). The red blood cells were lysed and centrifuged to obtain the white plaque cell layer (white blood cells); after adding trizol reagent, it was frozen at −80 ∘C for the subsequent isolation of leukocyte subtypes. The separation solution (Tianjin Haoyang biological products Technology Co., Ltd., Tianjin, China) was added to extract the neutrophils and monocytes. Finally, the monocytes were purified by differential attachment method. After the cells were collected, trizol reagent was added and the samples were frozen at −80 ∘C.

2.4 Extraction, labeling, and hybridization of RNA

Total RNA was extracted from leukocytes and their subtypes by trizol reagent (Invitrogen, CA, USA) and purified by mirVana™ miRNA Isolation Kit (AM1561) according to the manufacturer’s instructions. The OD260/280 reading was determined using a spectrophotometer (NanoDrop nd-1000) to determine the purity and concentration of RNA. The integrity of RNA was determined by 1% formaldehyde denaturing gel electrophoresis. Samples were labeled and array hybridized according to the gene expression analysis specification of monochromatic microarray (Agilent technique).

2.5 Microarray imaging and data analysis

The purified RNA was screened using Agilent lncRNAs expression microarray V4.0 (Agilent, Santa Clara, CA, USA). The chip scanner was used to scan the cleaned chip and obtain the hybrid picture, and the Agilent feature extraction (V10.7) software (Agilent, Santa Clara, CA, USA) was used to analyze the hybrid images and extract the data. Agilent gene printing software (Agilent, Santa Clara, CA, USA) was used to normalize the data and analyze the differences between groups, and thereby identify the lncRNAs with statistical differences. The differentially expressed genes were identified by random variance model, and p-value was calculated by paired t test. Up-regulated and down-regulated genes with fold change ≥2.0 and p ≤ 0.05 were considered as significant genes.

2.6 Functions and pathways analysis

GO (Gene Ontology) is an international standard classification system of gene function, including biological process, molecular function and cell composition. Through GOseq software (http://www.bioconductor.org/), according to the distribution relationship of differential genes in GO classification, enrichment analysis of differential genes was carried out. KEGG (Kyoto encyclopedia of genes and genomes) pathway analysis is a functional analysis that maps genes to KEGG pathway. According to KEGG pathway analysis (http://www.genome.jp/kegg/), the main pathway of the differential genes was determined. P < 0.05, was considered to indicate statistical difference between GO and pathway enrichment; the lower the p-value, the more obvious the enrichment difference [17].

2.7 Quantitative multi-polymerase chain reaction (qRT-PCR)

Differential gene expression between two groups was verified using qRT-PCR. According to the high-throughput screening, the difference multiple is large, the original expression amount is more than 300, and its regulatory signal pathway can be used as a candidate target gene in bioinformatics analysis. The total RNA was separated with trizol reagent and then reverse transcribed into cDNA using RNeasy Mini kit17 (Takara, Shiga, Japan) according to the manufacturer’s protocol. Primer 5.0 was used to design the primers for each lncRNAs, and BLAST (NCBI) was used to ensure the uniqueness of the amplified products. Theβ-actin (CST, Danvers, MA, USA) gene was selected as the endogenous reference gene. In the same way, the lncRNAs and its target genes were amplified (Table 1).

Table 1.Primer RNA sequence of qRT-PCR.
Primer sequence (5′ to 3′)
Probe
ENST00000430893.1-FACTGTGATTCCCCAGGTGATG
ENST00000430893.1-RGCTTCTTATTGTCTGCTCACTCCTT
ENST00000593848.5-FATACTAGATGCTGGGCTCAAGACA
ENST00000593848.5-RACCCTCTCTCCCAGCTTCCA
ENST00000536517.1-FTTGATCACCTTGACTGAAGCA
ENST00000536517.1-RTGTCTGGAAAATGCCATCTG
β-actin forward primerCTGGAACGGTGAAGGTGACA
β-actin reverse primerCGGCCACATTGTGAACTTTG
mRNA
β-actin forward primerAGGT CATCACCATT GGCAATGAGC
β-actin reverse primerAGCACTGTGTTGGCGTACAGGTCT
LNC2 forward primerTGTCCACAGCCAAGGGAAATAGC
LNC2 reverse primerGCAGGTTCTGGGTGGTTAGTTGG
SLC8A1 forward primerCCTTGTGGTTGGGACTAACAG
SLC8A1 reverse primerCCCAGCCATTCCAGTATTCAG
ERK1/2 forward primerCAAGAAAATCAGCCCCTTTGAG
ERK1/2 reverse primerAAGATCTGTTTCCATGAGGTCC
SLC8A1—solute carrier family 8 member A1, ERK—extracellular regulated kinase.

2.8 Cell culture and transfection

THP-1 cells (purchased from the Institute of Biochemistry and Cell Biology, Shanghai Institute of Life Sciences, Chinese Academy of Sciences, Shanghai, China) were cultured and sub-cultured in the complete cell culture medium with 10% fetal bovine serum. THP-1 cells (8 × 105) were inoculated into 24-well plates, and then the 1ug plasmid containing siRNA-lnc was transfected into the THP-1 cells by Life Technologies (Carlsbad, CA, USA) to inhibit the expression of our candidate lncRNA ENST00000593848.1. After transfection, lipopolysaccharide (LPS; 1 μg/mL; Sigma, St. Louis, MO, USA) was added to the cells, and the cell suspension was collected after 4 hours of culture for subsequent protein and mRNA detection.

2.9 Western blot

The total protein extracted from THP-1 cells was subjected to 10% sodium dodecyl sulfate-polyacrylamide Sigma-Aldrich, St. Louis, MO, USA) gel electrophoresis, and the separated proteins were transferred to PVDF (polyvinylidene fluoride) membrane (Minipore, Shanghai, China). The membrane was then incubated in 5% skim milk for 2 hours at room temperature, followed by incubation with primary antibody at 4 ∘C overnight. The membrane was then washed in PBS and incubated with appropriate secondary antibody (1:3000) for 2 hours at room temperature. All protein bands were detected by enhanced chemiluminescence Kit (Pierce, Rockford, IL, USA), and β-actin was used as the internal reference protein for group analysis.

2.10 Enzyme-linked immunosorbent assay (ELISA)

The concentrations of IL-6, CRP, and matrix metalloprotein 9 (MMP-9) in the supernatant of THP-1 cell culture medium and intracellular concentrations of Ca2+ were measured according to the instructions of the ELISA kit (CUSABIO, Wuhan, China).

2.11 Data analysis

All data are expressed as mean ± standard deviation. The data comparison between two groups was carried out by an independent sample t test. Comparison of more than two groups as done by one-way analysis of variance. The comparison between two groups adopted the least significant difference method. The area under receiver operating characteristic (ROC) curve (AUC) was compared for different lncRNAs to judge their diagnostic efficacy for AAD. All data were analyzed using SPSS19.0. (IBM, Armonk, NY, USA) and a p < 0.05 was considered to be statistically significant.

3. Results

3.1 Characteristics of patients and healthy controls

The lncRNA expression profile was examined in 5 patients with AAD and 5 healthy controls. The average age of the patients was 56 years old, and 60% and 40% of the patients displayed type A and type B AAD, respectively. There was no difference in age, hypertension, diabetes, and smoking behavior between the patient and control groups (p > 0.05, Table 2).

Table 2.Basic characteristics of patients with AAD and healthy control group.
VariableAAD (n = 5)Control (n = 5)p
Age, year56 ± 356 ± 9-
Male, n (%)4 (100)4 (100)-
Stanford type
Stanford A, n (%)3 (60)0-
Stanford B, n (%)2 (40)0-
Smoke, n (%)5 (100)5 (100)-
Hypertension, n (%)4 (80)4 (80)-
Hyperlipidemia, n (%)0 (0)0 (0)-
Diabetes, n (%)0 (0)0 (0)-
Marfan syndrome, n (%)0 (0)0 (0)-
Leukocyte count, (109/L)11.86 ± 3.375.98 ± 1.420.025
Neutrophils Percentage, (%)81.26 ± 8.5655.40 ± 9.330.002
Monocyte percentage, (%)9.53 ± 1.116.18 ± 0.260.034
IL-6, mg/L168.66 ± 99.170 (0 ± 3.3)0.028
CRP, mg/L113.75 ± 37.752.41 ± 1.840.021
D-dimer, mg/L9.57 ± 4.690.24 ± 0.100.007
AAD—Acute aortic dissection, CRP—c-reactive protein.

3.2 Expression profile of leukocyte lncRNAs

The expression of plasma lncRNAs and mRNA was examined in the patient and control groups using the human crystal core® lncRNA mRNA expression profile chip (the chip analysis was completed by Beijing Bo’ao company, Beijing, China). The microarray results showed that there was a significant difference in the expression profile of lncRNAs in leukocytes between the patient and control groups. A total of 26,235 lncRNAs were detected by microarray, including 540 up-regulated lncRNAs (>2-fold, p < 0.05) and 1078 down-regulated lncRNAs. Cluster analysis was carried out for the differentially expressed lncRNAs between the two groups. The respective expression values in the patient and control groups are expressed as the median. The fold change of each lncRNA and the corresponding p-value were mapped and subjected to GO and KEGG analysis to analyze the biological functions of the lncRNAs in leukocytes of the AAD patients (Fig. 1).

Differential expression of lncRNAs in patients with acute aortic 
dissection (AAD) and control individuals. Hierarchical clustering analysis of 
1618 lncRNAs that were differentially expressed in the two groups. (A) Expression 
values are represented in red and green, indicating expression above and below 
the median expression value in AAD patients (sample21, sample22, sample23, 
sample24, sample25) or control individuals (sample11, sample12, sample13, 
sample14, sample15), respectively. (B) Scatter plot of differential lncRNAs 
expression. X-axis: N-U, Y-axis: AMI-U. (C) Volcano plot of differential lncRNAs 
expression. X-axis: log2 fold change; Y-axis: −1 × log10 (corrected 
p-value) for each probes. (D) Biological functions of lncRNAs in 
leukocytes of AAD patients by GO pathway enrichment analysis.

Fig. 1. Differential expression of lncRNAs in patients with acute aortic dissection (AAD) and control individuals. Hierarchical clustering analysis of 1618 lncRNAs that were differentially expressed in the two groups. (A) Expression values are represented in red and green, indicating expression above and below the median expression value in AAD patients (sample21, sample22, sample23, sample24, sample25) or control individuals (sample11, sample12, sample13, sample14, sample15), respectively. (B) Scatter plot of differential lncRNAs expression. X-axis: N-U, Y-axis: AMI-U. (C) Volcano plot of differential lncRNAs expression. X-axis: log2 fold change; Y-axis: −1 × log10 (corrected p-value) for each probes. (D) Biological functions of lncRNAs in leukocytes of AAD patients by GO pathway enrichment analysis.

3.3 Network interpretation of the co-expression of lncRNAs and mRNA

To verify the results of co-expression between lncRNAs and mRNA, the co-expression network was analyzed. The data of different lncRNAs and mRNA genes were combined to calculate the correlation between each gene in the two sets of data, and the correlation coefficient and corresponding p-values were obtained. The p-value indicates the reliability of measuring the correlation between genes. Based on the similarity of gene expression, the possible interaction between the genes was analyzed, and the degree of interaction was quantified; degree = 10 represents that there are 10 genes related to the gene, and a larger degree reflects a higher number of genes interactions [18]. Based on the degree of each gene in the gene synergy network, the key genes in the network were obtained (Table 3).

Table 3. LncRNA and mRNA co-expression network analysis (degree ≥10).
GeneDegreeRegulationTypeFoldp
ENST00000430893.112p36791_v4DownLncRNA2.470.004
ENST00000536517.111p3447DownLncRNA3.150.005
ENST00000545508.110p3446DownLncRNA3.20.014
ENST00000589556.110p8716DownLncRNA3.170.002
ENST00000433933.19p10197DownLncRNA2.650.014
ENST00000593848.18p34791 v4UpLncRNA2.640.004
ENST00000596307.18p11741downLncRNA4.120.02
DNHD111DownmRNA--
TMEM1911DownmRNA--
ADAM2310DownmRNA--
HERC2P49DownmRNA--
C3orf188DownmRNA--
HTATIP28UpmRNA--
LIN7A8UpmRNA--

3.4 Verification of chip results

Based on the above information, combined with the needs of clinical research, the possible biomarkers were selected from 174 up-regulated lncRNAs, and the conditions were defined as: average basic intensity >8, multiple of difference >2, p ≤ 0.005, and lncRNA co-expressed with mRNA (AAD group: degree ≥10; control group: degree ≥8). After screening, only three lncRNAs met these criteria: ENST00000430893.1, ENST00000536517.1, and ENST00000593848.1. To further identify the origin of the three lncRNAs, neutrophils and monocytes from another group of independent population (20 patients with AAD and 10 controls) were isolated, and the expression of the three lncRNAs was examined by qRT-PCR. The expression of ENST00000430893.1, ENST0000536517.1, and ENST0000593848.1 in neutrophils of AAD patients was 0.98 times (p = 0.703), 0.60 times (p < 0.001) and 1.58 times (p = 0.010) higher than that of the control group, respectively. The expression levels of ENST00000430893.1, ENST00000536517.1, and ENST00000593848.1 in mononuclear cells of AAD patients were 1.21 times (p = 0.501), 0.62 times (p = 0.001) and 1.32 times (p = 0.094) higher than those of the control group, respectively (Fig. 2).

Real-time fluorescence quantitative multi-polymerase chain 
reaction to verify the chip results. AAD, acute aortic dissection; Control, 
healthy volunteers.

Fig. 2. Real-time fluorescence quantitative multi-polymerase chain reaction to verify the chip results. AAD, acute aortic dissection; Control, healthy volunteers.

3.5 The diagnostic value of lncRNAs for AAD

In ROC curve analysis, the AUC of ENST00000430893.1, ENST00000536517.1, and ENST00000593848.1 in neutrophils was 0.440 (p = 0.598), 0.885 (p = 0.001), and 0.790 (p = 0.011); the AUC of ENST00000430893.1, ENST00000536517.1, and ENST00000593848.1 in monocytes was 0.581 (p = 0.481), 0.880 (p = 0.001), and 0.725 (p = 0.048), respectively (Fig. 3).

The diagnostic value of lncRNAs of leukocytes for acute aortic 
dissection (AAD) by receiver operating characteristic (ROC) curve.

Fig. 3. The diagnostic value of lncRNAs of leukocytes for acute aortic dissection (AAD) by receiver operating characteristic (ROC) curve.

3.6 Expression of inflammatory factors

The expression of lnc2 was detected 48 hours after the transfection of SINC, SILNC2-1, and SILNC2-2. The results showed that both SILNC2-1 and SILNC2-2 could effectively reduce the expression of lnc2 in THP-1 cells compared with that in the SINC group (p < 0.05). Compared with the SINC group, SILNC2-1 and SILNC2 groups showed increased Ca2+ concentration in THP-1 cells after LPS induction (p < 0.05); SILNC2-2 group showed significantly increased IL-6 secreted by THP-1 cells after LPS induction (p < 0.05) (Fig. 4). However, the SILNC2-1 and SILNC2-2 groups did not show significantly increased CRP secretion by THP-1 cells after LPS induction.

The expression of lnc2 was detected 48 hours after the 
transfection of SINC, SILNC2-1, and SILNC2-2. Intracellular Ca2+ 
concentration and the concentration of IL-6, CRP, MMP9 of cell culture medium in 
each group were tested by ELISA kit. (A) The expression of LNC2 was detected at 
48 hours after the transfection of SINC, SILNC2-1 and 
SILNC2-2. (B) Intracellular Ca2+ concentration of each group were 
tested by ELISA kit. (C, D and E). The concentration of IL-6, CRP, MMP9 
in the supernatant of cell culture medium of each group were tested by ELISA kit. 
&amp;p &lt; 0.05 compared with blank control group; #p &lt; 0.05 
compared with group of LPS; *p &lt; 0.05 compared with SINC.

Fig. 4. The expression of lnc2 was detected 48 hours after the transfection of SINC, SILNC2-1, and SILNC2-2. Intracellular Ca2+ concentration and the concentration of IL-6, CRP, MMP9 of cell culture medium in each group were tested by ELISA kit. (A) The expression of LNC2 was detected at 48 hours after the transfection of SINC, SILNC2-1 and SILNC2-2. (B) Intracellular Ca2+ concentration of each group were tested by ELISA kit. (C, D and E). The concentration of IL-6, CRP, MMP9 in the supernatant of cell culture medium of each group were tested by ELISA kit. &p < 0.05 compared with blank control group; #p < 0.05 compared with group of LPS; *p < 0.05 compared with SINC.

3.7 Target genes and possible signaling pathways

Compared with the control group, the LPS group showed a significantly down-regulated level of solute carrier family 8 member A1 (SLC8A1) mRNA in THP-1 cells (p < 0.05) (Fig. 5). Compared with SINC group, both SILNC2-1 and SILNC2-2 groups showed significantly upregulated levels of SLC8A1 and ERK1/2 mRNA in THP-1 cells after LPS induction (p < 0.05). Compared with SINC group, both SILNC2-1 and SILNC2-2 groups showed significant activation of the NF-κB/p65 signaling pathway in THP-1 cells after LPS induction (p < 0.05). Compared with the control group, the LPS group showed increased p-ERK1/2 activity in THP-1 cells (p < 0.05).

Relative SLC8A1 and ERK mRNA expression level and differential 
expression of target protein signaling pathway related proteins in each group. (A and B) relative SLC8A1 and ERK mRNA expression level were tested by real-time fluorescence quantitative multi-polymerase chain reaction. 
(C, D and E) expression of target protein signaling pathway related proteins in 
each group of cells by Western Blot. &amp;p &lt; 0.05 compared with blank 
control group; #p &lt; 0.05 compared with group of LPS; *p &lt; 
0.05 compared with SINC.

Fig. 5. Relative SLC8A1 and ERK mRNA expression level and differential expression of target protein signaling pathway related proteins in each group. (A and B) relative SLC8A1 and ERK mRNA expression level were tested by real-time fluorescence quantitative multi-polymerase chain reaction. (C, D and E) expression of target protein signaling pathway related proteins in each group of cells by Western Blot. &p < 0.05 compared with blank control group; #p < 0.05 compared with group of LPS; *p < 0.05 compared with SINC.

4. Discussion

AAD is a serious disease, because early diagnosis is difficult and there is no efficient therapy for patients with AAD [2]. Therefore, exploring new biomarkers and studying the underlying pathophysiological mechanism may provide better diagnosis and treatment strategies for AAD. In this study, gene chip technology was used to study the whole genome expression patterns of lncRNAs and mRNA in leukocytes of 5 AAD patients and 5 healthy volunteers. We found 174 up-regulated lncRNAs in leukocytes of AAD patients compared with those in healthy controls. These lncRNAs were screened based on the needs of clinical research and conditions; only three lncRNAs, namely ENST000000430893.1, ENST0000536517.1, and ENST0000593848.1 met these screening criteria. We further verified the results in 20 patients with AAD and 10 healthy volunteers. The results showed that these lncRNAs were stably expressed in leukocytes, mainly in neutrophils and monocytes.

Previous studies using Agilent microarray analysis have identified a large number of lncRNAs that show significant differential expression in the plasma of patients with cardiovascular disease [19, 20, 21]. Recent studies found that lncRNAs also show differential expression in monocytes of patients with myocardial infarction, among which lncRNAs H19, metastasis associated in lung denocarcinoma transcript 1 (MALAT1) and myocardial infarction association tran-script (MIAT) have strong early diagnostic value for acute myocardial infarction [16]. This indicates that lncRNAs may be a new and promising direction for biomarkers in the future. The current study also indicated that the differential expression of lncRNAs in neutrophils may have a high diagnostic potential for AAD. Therefore, we used ROC curve analysis to test this hypothesis. The results showed that the AUC of AAD was 0.885 (neutrophils) and 0.880 (monocytes) in case of ENST00000536517.1, and 0.790 (neutrophils) and 0.725 (monocytes) in case of ENST00000593848.1, suggesting that these lncRNAs may be an early diagnostic biomarker for AAD; however, this should be verified using a larger clinical cohort.

lncRNAs are of value not only for early diagnosis in AAD, but also for providing insights into the intrinsic pathophysiological mechanism of the disease. Hence, our findings are expected to provide novel strategies for disease treatment and improve the prognosis of critical patients in the future. In this study, based on the degree of differential expression in patients with AAD and healthy patients, along with the expression observed in leukocytes, predicted target genes, and AUC analysis results for early diagnosis, we chose ENST0000593848.1 for further investigation of the role of lncRNAs in the inflammatory response of AAD and possible underlying mechanisms. Firstly, we used the lncRNA database, and identified the target gene of ENST00000593848.1 as SLC8A1, which is mainly responsible for encoding a sodium calcium exchanger, and regulating the intracellular and extracellular calcium concentration through Na+ influx and Ca2+ efflux [22]. Our data showed that inhibition of ENST00000593848.1 significantly increased SLC8A1 expression and LPS-induced Ca2+ concentration in THP-1 cells compared with those in the control group. Previous studies have found that calcium influx is a necessary condition for activation of an inflammatory cell, including neutrophils, monocytes, and macrophages [23]. After the immune cells receive stimulation, the increase in intracellular calcium concentration stimulates the proliferation of inflammatory cells and the release of inflammatory factors such as tumor necrosis factor α (TNF-α), IL-6, interleukin-8 (IL-8), and granulocyte macrophage colony stimulating factor (GM-CSF) [24]. However, it remains unclear if serum inflammatory markers may reflect clinical stability, and its kinetics lag behind clinical presentation [24]. Our data showed a significant increase in IL-6 and CRP concentrations in the SILNC2-1 and SILNC2-2 groups. Therefore, ENST0000593848.1 in leukocytes in AAD patients may play an anti-inflammatory role by inhibiting calcium influx.

Previous studies have shown that Ca2+ can activate ERK by activating the Ras signaling pathway and upregulating nuclear transcription factors, such as NF-κB and p65 [25, 26]. NF-κB is an important regulatory factor in inflammatory responses. Many factors in various stages of immune inflammatory response are regulated by NF-κB, including TNF-α, IL-1β, IL-2, IL-6, IL-8, interleukin-12 (IL-12), Inducible nitric oxide synthase (iNOS), cyclooxygenase 2 (COX 2), chemokines, adhesion molecules, and colony stimulating factor [27, 28]. The results showed that inhibition of ENST00000593848.1 could increase ERK expression activity and upregulate NF-κB activity. Therefore, the inhibitory effect of ENST00000593848.1 may be mediated by inhibition of the NF-κB signaling pathway.

This study has its limitations. Importantly, it is a single-center study with a small sample size which is unable to improve statistical efficacy. And because of the small sample size, the relationship between IncRNAs and adverse events of AAD is not clear. Our results should be validated among patients from different regions and populations in future large-scale, multicenter research. In addition, we didn’t dynamically capture biomarker changes and cannot dynamically analyze the link between IncRNA and the development of AAD. Furthermore, no animal experiments were conducted in this study to verify whether ENST00000593848.1 inhibitor can regulate the inflammation of the aortic vessel wall in AAD model, and whether it can reduce the morbidity and mortality of AAD. Future research should investigate this hypothesis.

5. Conclusion

There are many lncRNAs that show differential expression profiles in leukocytes of AAD patients and healthy people, among which lncRNAs ENST00000430893.1, ENST00000536517.1, and ENST00000593848.1 have the potential to be used as biomarkers for early diagnosis or prognosis of AAD. In the model of monocyte macrophage inflammation induced by LPS, inhibition of the lncRNA ENST00000593848.1 aggravated the inflammation, suggesting that this lncRNA may play an anti-inflammatory role in patients with AAD, and that the increased expression of ENST00000593848.1 in leukocytes of patients with AAD may be due to negative feedback regulatory mechanisms during the inflammatory response.

Author contributions

TYL, YWZ, SZ—conception and design; TYL, YWZ—data curation; TYL, TYL, YWZ, SZ—methodology; TYL, YWZ—writing original draft; TYL, YWZ, DZL, ZZ, SZ—manuscript proofing and final approval of the manuscript, all authors read and approved the final manuscript.

Ethics approval and consent to participate

The study was conducted in accordance with the Declaration of Helsinki, and the study protocol was approved by the Human Ethical Committee of West China Hospital of Sichuan University and the China Ethics Committee of Registering Clinical Trial (ChiECRCT-20150063). All study subjects provided written informed consent.

Acknowledgment

We thank Yarong He for her assistance in screening several English full texts and dealing with the figures. We also thank all the peer reviewers for their opinions and suggestions.

Funding

This research was funded by Science and Technology Department of Sichuan Province, grant number 2017JY033.

Conflict of interest

The authors declare no conflict of interest.

References

Humphrey JD, Schwartz MA, Tellides G, Milewicz DM. Role of mechanotransduction in vascular biology: focus on thoracic aortic aneurysms and dissections. Circulation Research. 2015; 116: 1448–1461.

[Google Scholar]

Erbel R, Aboyans V, Boileau C, Bossone E, Bartolomeo RD, Eggebrecht H, et al. 2014 ESC guidelines on the diagnosis and treatment of aortic diseases: document covering acute and chronic aortic diseases of the thoracic and abdominal aorta of the adult. the task force for the diagnosis and treatment of aortic diseases of the European society of cardiology (ESC). European Heart Journal. 2014; 35: 2873–2926.

[Google Scholar]

Khan IA, Nair CK. Clinical, diagnostic, and management perspectives of aortic dissection. Chest. 2002; 122: 311–328.

[Google Scholar]

Wu D, Shen YH, Russell L, Coselli JS, LeMaire SA. Molecular mechanisms of thoracic aortic dissection. Journal of Surgical Research. 2013; 184: 907–924.

[Google Scholar]

del Porto F, Proietta M, Tritapepe L, Miraldi F, Koverech A, Cardelli P, et al. Inflammation and immune response in acute aortic dissection. Annals of Medicine. 2010; 42: 622–629.

[Google Scholar]

Chen ZR, Huang B, Lu HS, Zhao ZH, Hui RT, Yang YM, et al. Admission white blood cell count predicts short-term clinical outcomes in patients with uncomplicated stanford type B acute aortic dissection. Journal of geriatric cardiology. 2017; 14: 49–56.

[Google Scholar]

Fan X, Huang B, Lu H, Zhao Z, Lu Z, Yang Y, et al. Impact of admission white blood cell count on short- and long-term mortality in patients with type a acute aortic dissection: an observational study. Medicine. 2015; 94: e1761.

[Google Scholar]

Esmon CT. Molecular circuits in thrombosis and inflammation. Thrombosis and Haemostasis. 2013; 109: 416–420.

[Google Scholar]

Nagareddy P, Smyth SS. Inflammation and thrombosis in cardiovascular disease. Current Opinion in Hematology. 2013; 20: 457–463.

[Google Scholar]

Guttman M, Rinn JL. Modular regulatory principles of large non-coding RNAs. Nature. 2012; 482: 339–346.

[Google Scholar]

An JH, Chen ZY, Ma QL, Wang HJ, Zhang JQ, Shi FW. LncRNA SNHG16 promoted proliferation and inflammatory response of macrophages through miR-17-5p/NF-κB signaling pathway in patients with atherosclerosis. European Review for Medical and Pharmacological Sciences. 2019; 23: 8665–8677.

[Google Scholar]

Greco S, Gaetano C, Martelli F. Long noncoding competing endogenous RNA networks in age-associated cardiovascular diseases. International Journal of Molecular Sciences. 2019; 20: 3079.

[Google Scholar]

Shi Q, Yang X. Circulating MicroRNA and long noncoding RNA as biomarkers of cardiovascular diseases. Journal of Cellular Physiology. 2016; 231: 751–755.

[Google Scholar]

Viereck J, Thum T. Circulating noncoding RNAs as biomarkers of cardiovascular disease and injury. Circulation Research. 2017; 120: 381–399.

[Google Scholar]

Zhuo X, Wu Y, Yang Y, Gao L, Qiao X, Chen T. LncRNA AK094457 promotes AngII-mediated hypertension and endothelial dysfunction through suppressing of activation of PPARγ. Life Sciences. 2019; 233: 116745.

[Google Scholar]

Wang XM, Li XM, Song N, Zhai H, Gao XM, Yang YN. Long non-coding RNAs H19, MALAT1 and MIAT as potential novel biomarkers for diagnosis of acute myocardial infarction. Biomedicine & Pharmacotherapy. 2019; 118: 109208.

[Google Scholar]

Kanehisa M, Goto S, Kawashima S, Okuno Y, Hattori M. The KEGG resource for deciphering the genome. Nucleic Acids Research. 2004; 32: D277–D2280.

[Google Scholar]

Barabási A, Oltvai ZN. Network biology: understanding the cell’s functional organization. Nature Reviews Genetics. 2004; 5: 101–113.

[Google Scholar]

Wang Y, Wu T, Zou L, Xiong L, Zhang T, Kong L, et al. Genome-wide identification and functional analysis of long non-coding RNAs in human endothelial cell line after incubation with PM2.5. Chemosphere. 2019; 216: 396–403.

[Google Scholar]

Zhai H, Li X, Liu F, Chen BD, Zheng H, Wang X, et al. Expression pattern of genome-scale long noncoding RNA following acute myocardial infarction in Chinese Uyghur patients. Oncotarget. 2017; 8: 31449–31464.

[Google Scholar]

Zhou XR, Song N, Luo JY, Zhai H, Li XM, Zhao Q, et al. Expression profiles and potential functions of long non-coding RNA in stable angina pectoris patients from Uyghur population of China. Bioscience Reports. 2019; 39: BSR20190364.

[Google Scholar]

Khananshvili D. The SLC8 gene family of sodium-calcium exchangers NCX- structure, function, and regulation in health and disease. Molecular Aspects of Medicine. 2013; 34: 220–235.

[Google Scholar]

Tintinger G, Steel HC, Anderson R. Taming the neutrophil: calcium clearance and influx mechanisms as novel targets for pharmacological control. Clinical and Experimental Immunology. 2005; 141: 191–200.

[Google Scholar]

Vaeth M, Yang J, Yamashita M, Zee I, Eckstein M, Knosp C, et al. ORAI2 modulates store-operated calcium entry and T cell-mediated immunity. Nature Communications. 2017; 8: 14714.

[Google Scholar]

Liu Z, Jiang L, Li Y, Xie B, Xie J, Wang Z, et al. Cyclosporine a sensitizes lung cancer cells to crizotinib through inhibition of the Ca2+/calcineurin/Erk pathway. EBioMedicine. 2019; 42: 326–339.

[Google Scholar]

Pan PJ, Tsai JJ, Liu YC. Amentoflavone inhibits metastatic potential through suppression of ERK/NF-κB activation in osteosarcoma U2OS cells. Anticancer Research. 2017; 37: 4911–4918.

[Google Scholar]

Hiransai P, Ratanachaiyavong S, Itharat A, Graidist P, Ruengrairatanaroj P, Purintrapiban J. Dioscorealide B suppresses LPS-induced nitric oxide production and inflammatory cytokine expression in RAW 264.7 macrophages: the inhibition of NF-kappaB and ERK1/2 activation. Journal of Cellular Biochemistry. 2010; 109: 1057–1063.

[Google Scholar]

Indra MR, Karyono S, Ratnawati R, Malik SG. Quercetin suppresses inflammation by reducing ERK1/2 phosphorylation and NF kappa B activation in Leptin-induced Human Umbilical Vein Endothelial Cells (HUVECs). BMC Research Notes. 2013; 6: 275.

[Google Scholar]