Isoflurane ameliorates oxygen-glucose deprivation-induced cardiomyocyte injury through SIRT6/DNMT1 pathway

2.1 Cell culture

The cardio myoblast H9c2 cell line was purchased from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China) and cultured in Dulbecco’s modified Eagle’s medium (Sigma, USA) at 37 °C. In order to establish H/R model, H9c2 cells were maintained in non-glucose and serum-free DMEM at 37 °C for 8 hours under hypoxic conditions (1% O₂/95% N₂). After hypoxic exposure, H9c2 cells were placed to reoxygenation at 37 °C in a normal incubator (95% air/5% CO₂) and divided into five groups: Control, OGD, OGD + ISO, OGD + ISO + OSS_128167 (20 μM), OGD + ISO + DNMT1. 3 hours after OGD treatment, cells were exposed to 1.5 % of isoflurane (ISO, Baxter Healthcare Corporation, Deerfield, IL, USA) for 30 min at 2 L/min. For overexpression of DNMT1, the Lipofectamine 2000 transfection reagent (Invitrogen) was used to transfected the plasmids to the H9c2 cells.

2.2 Cell Counting Kit-8 (CCK8) assay

The viability of H9c2 cell was measured by CCK8 assay (Abcam, Cambridge, USA). H9c2 cells were cultured into 96-well plates (1500 cells/well). Cell viabilities at 0, 24, 48 and 72 hours were subsequently detected. CCK8 solution (10 μL/well) was added for 1.5 hours at 37 °C. The optical density of the viability curve was quantitated at 450 nm by a microplate reader.

2.3 Western blot

The total protein from H9c2 cells was collected by RIPA buffer and centrifuged at 12,000 g. 30 μg protein samples were separated via 8% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel and the nitrocellulose membranes (Sigma-Aldrich, St. Louis, MO, USA) were used to transfer proteins. The primary antibodies against SIRT6 (1:1000, ab62739, Abcam, Cambridge, MA, USA), DNMT1 (1:2000, sc-271729, Santa Cruz Biotechnology, Santa Cruz, Ca, USA), Bax (1:5000, ab182734, Abcam), Bcl-2 (1:3000, 2876, Cell Signaling Technology, Inc., Danvers, Massachusetts, USA) and β-actin (1:10,000, sc-47778, Santa Cruz Biotechnology) overnight at 4 °C. The membrane was cultured with horseradish peroxidase‑labeled secondary antibody at 37 °C for 1 hour, and the band of proteins was measured by the enhanced chemiluminescence (Sigma-Aldrich). The internal control was β-actin.

2.4 Quantitative real-time PCR

H9c2 cells were harvested and the TRIZOL reagent (Invitrogen) was used to extract the total RNA. A total RNA was reversed by using universal cDNA synthesis and SYBR Green Master Mix kits incorporation on Roche Light-Cycler480 Real Time PCR system (Roche, Penzberg, Germany). The SIRT6 and DNMT1 primers were as follows:

SIRT6:

Forward (5’-3’): GCCGTCTGGTCATTGTCA;

Reverse (5’-3’): AGCCTTGGGTGCTACTGG;

DNMT1:

Forward (5’-3’): GTTCCTCCTTCTGCCATCAAT;

Reverse (5’-3’): CGTCTCATCATCGTCCTTAGC.

2.5 Measurements of Lactate dehydrogenase (LDH), Creatine Kinase MB (CK-MB) and Cardiac Troponin I (cTnI) levels

The levels of LDH (Abcam), CK-MB (BioVision, Palo Alto, USA) and cTnI (My Biosource, CA, USA) from heart tissue, serum and culture medium were quantitative by the commercial kits according to the manufacturer’s protocols.

2.6 Measurements of TNF-α, IL-1β and IL-6 levels

The levels of pro-inflammatory molecule expression were assessed from cultured H9c2 cells, using commercial Interleukin-6 (IL-6), Tumor Necrosis Factor-α (TNF-α), and IL-1β ELISA Kits (ab46087, ab178013, ab46052, Abcam, Cambridge, MA, USA) according to the manufacturer’s protocols. The plates were analyzed at the absorbance of 450 nm.

2.7 Flow cytometry

H9c2 cells were detached with trypsin and harvested with a binding buffer. Then, H9c2 cells were cultured with Annexin V/FITC and propidium iodide from Dead Cell Apoptosis Kit (Thermo Fisher Scientific, San Jose, CA, USA) following the manufacturer’s protocols. The fluorescence signal was analyzed by a flow cytometer (BD Biosciences, San Jose, CA, USA). Each experimental group’s portion of apoptotic cells was calculated as the sum of early and late apoptosis.

2.8 Statistical analysis

All data were analyzed using Statistical Product and Service Solutions (SPSS) 19.0 (SPSS Inc., Chicago, IL, USA) software package. Data were expressed as mean ± standard error of the mean (SEM). The differences between groups were performed with one-way Analysis of variance (ANOVA) followed by Tukey’s post hoc test. p value < 0.05 was defined as statistically significant.

3.1 Isoflurane down-regulates the expression of DNMT1 by activating SIRT6 in H9c2 cells with H/R injury

To investigate the effect of Isoflurane on oxygen-glucose deprivation (OGD) treated H9c2 cells, the level of SIRT6 and DNMT1 were analyzed by western blot and qPCR, respectively. To induce OGD, H9c2 cells were exposed to H/R conditions. SIRT6 expression was significantly suppressed, while DNMT1 was enhanced in the OGD group compared with that of the control group (Fig. 1A,B). Conversely, compared with the OGD group, the Isoflurane treatment groups remarkably induced SIRT6 expression and attenuated DNMT1 expression. Furthermore, the effect of Isoflurane in OGD-treated H9c2 cells was reversed by SIRT6 inhibitor OSS_128167. The results indicate that Isoflurane inhibits DNMT1 expression by SIRT6 activation.

Fig. 1.Effects of isoflurane on SIRT6/DNMT1 expression after OGD exposure in H9c2 cells. (A) The mRNA expressions of SIRT6 and DNMT1 were analyzed by qRT-PCR. (B) The protein expressions of SIRT6 and DNMT1 were evaluated by western blot analysis. *** p < 0.005 vs. Control. ^###p < 0.005 vs. OGD. ^&&p < 0.001 vs. OGD + ISO. ^&&&p < 0.005 vs. OGD + ISO. Data are expressed as mean ± SEM.

3.2 Isoflurane ameliorates OGD-induced H9c2 cell injury through SIRT6/DNMT1 pathway

To determine whether Isoflurane contributes to the myocardial protective effect against H/R-induced cellular damage, the level of cardio injury-related proteins LDH, CK-MB, cTnl, and cell viability were assessed. CCK8 assay was used to examine cell viability. CCK8 assay and western blot analysis revealed that OGD remarkably suppressed cell viability and enhanced the levels of cardio-injury-related proteins in H9c2 cells (Fig. 2A,B). Conversely, cotreatment with Isoflurane significantly enhanced cell viability and down-regulated cardio-injury-related proteins level compared with those in the OGD group. Additionally, these above changes were reversed after cotreatment with SIRT6 inhibitors or overexpression of DNMT1 (Fig. 2A,B). These results suggest that Isoflurane ameliorates OGD-induced cellular damage through SIRT6/DNMT1 pathway.

Fig. 2.Effects of isoflurane on OGD-induced H9c2 cell injury through SIRT6/DNMT1 pathway. (A) After OGD exposure, cell viability in different groups was determined by CCK8 assay. (B) The protein expressions of LDH, CK-MB and cTnl were assessed by using commercial kits. *** p < 0.005 vs. Control. ^###p < 0.005 vs. OGD. ^&p < 0.05 vs. OGD + ISO. ^&&p < 0.001 vs. OGD + ISO. Data are expressed as mean ± SEM.

3.3 Isoflurane improves OGD-induced inflammatory damage in H9c2 cell through SIRT6/DNMT1 pathway

To explore the effect of Isoflurane on OGD-induced inflammatory damage, the levels of cytokines of inflammatory response were detected by commercial ELISA kits. Compared with the OGD group, the OGD + ISO group showed lower levels of TNF-α, IL-1β, and IL-6. Additionally, these above changes were reversed after cotreatment with SIRT6 inhibitors or overexpression of DNMT1 (Fig. 3). These results indicated that Isoflurane ameliorates OGD-induced inflammatory damage through SIRT6/DNMT1 pathway.

Fig. 3.Effects of isoflurane on OGD-induced inflammatory damage in H9c2 cell by SIRT6/DNMT1 pathway. After OGD exposure, the TNF-α, IL-6 and IL-1β levels were assessed by using ELISA assay. *** p < 0.005 vs. Control. ^###p < 0.005 vs. OGD. ^&&p < 0.001 vs. OGD+ ISO. ^&&&p < 0.005 vs. OGD + ISO. Data are expressed as mean ± SEM.

3.4 Isoflurane ameliorates OGD-induced cellular apoptosis in H9c2 cell through SIRT6/DNMT1 pathway

To clarify the potential mechanism underlying the effects of Isoflurane on inhibiting OGD-induced apoptosis, cell apoptotic rate was measured by cell apoptosis kit with Annexin V-FITC and western blot analysis. The results from flow cytometry assay determined that the apoptotic rate of the OGD group was obviously higher than that of the OGD + ISO group, while the apoptotic rate was significantly increased after cotreatment with SIRT6 inhibitors or overexpression of DNMT1 (Fig. 4A). Western blot analysis showed consistent results, showing that the expression level of Bax in OGD + ISO group was decreased while the expression level of Bcl-2 was suppressed, compared with that in the OGD group. Cotreatment with SIRT6 inhibitors or overexpression of DNMT1 group exhibited significantly higher expression level of Bax and a lower level of Bcl-2 expression (Fig. 4B). These results strongly indicate that Isoflurane improves OGD-induced cellular apoptosis in H9c2 cell through SIRT6/DNMT1 pathway.

Fig. 4.Effects of isoflurane on OGD-induced H9c2 cell apoptosis by SIRT6/DNMT1 pathway. (A) Flow cytometry assay was used to measure the apoptotic rate of H9c2 cell after isoflurane treatment. (B) The apoptotic related protein (Bax and Bcl-2) expressions were evaluated by using western blot analysis. *** p < 0.005 vs. Control. ^###p < 0.005 vs. OGD. ^&&p < 0.001 vs. OGD+ ISO. ^&&&p < 0.005 vs. OGD + ISO. Data are expressed as mean ± SEM.