HOMER1A restores sevoflurane-induced cognitive dysfunction by regulating microglia’s activation through activating the AMPK/TXNIP axis

2.1 Animal study

The male Sprague-Dawley rats (n = 42, 260–280 g, 15 months) were acquired from Vital River Laboratory Animal Technology Co. Ltd. (Beijing, China). All rats were kept in individual cages, and given free water and food under a 12-h light/dark cycle for one week for environmental adaptation. This study was approved by the Animal Care and Use Committee of Shanxi Provincial People’s Hospital.

To construct adeno-associated virus (AAV) vector, HOMER1A cDNA sequence was cloned into the multi cloning site (MCS) of pAAV-CAGGS-EGFP-P2A-MCS plasmid [18]. In general, the AAV vectors pHelper (Cell BioLabs, San Diego, CA, USA) and pAAV-DJ (Cell BioLabs) were transfected into the HEK293 cells. Post incubation for 3 days, the cells were collected, and the AAV titers were estimated through real time-quantitative polymerase chain reaction (RT-qPCR). Rats were anesthetized with tribromoethanol (250 mg/kg) and placed in a stereotactic frame (David Kopf, Tujunga, CA, USA). The AAV virus (0.5 μL, 1.0 × 10¹¹ genome copies/mL) was injected into the hippocampus through a glass microinjection capillary tube at a rate of 0.1 μL/min (0.5 μL/site, six sites). The rates relative to the bregma were as followed (in mm): −2.0, ±1.8, −2.2; −2.0, ±1.8, −1.7; −2.8, ±3.0, −3.0.

HOMER1A: (sequence: GGAATCAGCAGGAGGAGATCT) [12].

The rats were randomly separated into 7 groups:

(1) rats (n = 6) were set in the blank control group (Sham group); (2) rats (n = 6) were anesthetized in 2% SEV for 5 h to set in the SEV group (SEV group); (3) rats (n = 6) were injected with AAV-NC in the Sham + AAV-NC group; (4) rats (n = 6) were injected with AAV-HOMER1A in the Sham + AAV-HOMER1A group; (5) rats (n = 6) induced by SEV were injected with AAV-NC in the SEV + AAV-NC group; (6) rats (n = 6) induced by SEV were injected with AAV-HOMER1A in the SEV + AAV-HOMER1A group; (7) rats (n = 6) induced by SEV were injected with AAV-HOMER1A and treated with CC (20 mg/kg, AMPK inhibitor) in the Sham + AAV-HOMER1A + CC group. The Morris water maze (MWM) test was utilized to evaluate their behaviors and functions of learning and memory. At last, rats were sacrificed by intraperitoneal anesthesia with pentobarbitone (800 mg/kg). Half of the rats’ brain tissue was fastened in 4% paraformaldehyde, and the other half was kept in liquid nitrogen.

2.2 H&E staining

The brain tissues fastened in paraformaldehyde were dehydrated through different concentrations of alcohols, followed by paraffin-embedding. Next, tissues were cut into 4-μm thick sections, and then dyed with hematoxylin for 5 min and eosin for 30 s. The light microscope (BX53T-32P01, Olympus Corporation, Tokyo, Japan) was utilized to observe the pathological changes of the brain.

2.3 Morris water maze (MWM) test

The MWM test was utilized to evaluate the learning and memory abilities of rats. The acquisition test was done for 4 days (twice a day). On the 5th day, the spatial probe test was carried out. The learning and memory abilities in rats were evaluated through the acquisition test. At the fixed entry point of each quadrant, rats were put into the water in random order. The time of searching in the water and climbing on the platform was deemed as the escape latency, and rats kept on the platform for more than 3 s. If rats don’t climb the platform within 120 seconds, manually guide them to the platform with a stick and made them to stay the platform for 30 s, and then put them back into the cage for the next test. The spatial memory ability of rats was evaluated through spatial probe method. After removing the platform from the pool, at the opposite side of the original target quadrant, the rats were put into the water and permitted to seek the platform. We recorded the number of passing through the platform within 120 s and counted the proportion (the time in the original target quadrant/the total time).

2.4 ELISA

Enzyme-linked immunosorbent assay (ELISA) was conducted to confirm the levels of brain injury markers (S-100β and NSE) and inflammatory factors (tumor necrosis factor-α (TNF-α), Interleukin-6 (IL-6) and Interleukin-1β (IL-1β)) in serum. The S-100β (SEA567Ra, USCN, USA), the neuron-specific enolase (NSE) (SEA537Ra, USCN), TNF-α (SEA133Si, USCN), IL-6 (SEA079Ra, USCN) and IL-1β (CSB-E08055r, CUSABIO) were measured through commercial ELISA kits in line with the manufacturer’s instructions.

2.5 RT-qPCR

The extraction of RNAs was conducted using Trizol. Then, the reverse transcription of the RNAs to cDNAs was executed using the reverse transcription kit (RR037A, Takara, Kyoto, Japan). Real-time quantitative PCR was carried out using the SYBR Premix PCR kit (RR820B, Takara, Kyoto, Japan). The 2^−ΔΔCt method was utilized for the calculation the relative expression of HOMER1A, TNF-α, IL-6, IL-1β, with normalizing to glyceraldehyde-3-phosphate dehydrogenase (GAPDH, the internal standard). The primers were presented as follows:

HOMER1A

F: 5′-ATAGCACCATCACTCCAAA-3′,

R: 5′-GAATCCCAGTCCATAAACA-3′;

TNF-α

F: 5′-AGCCGATGGGTTGTACCT-3′,

R: 5′-TGAGTTGGTCCCCCTTCT-3′;

IL-6

F: 5′-TCCAGTTGCCTTCTTGGGAC-3′,

R: 5′-GTACTCCAGAAGACCAGAGG-3′;

IL-1β

F: 5′-CCAGCTTCAAATCT CACAGCAG-3′,

R: 5′-CTTCTTTGGGTATTGCTTGGGATC-3′;

GAPDH

F: 5′-CAAGTTCAACGGCACAG-3′,

R: 5′-CCAGTAGACTCCACGACAT-3′.

2.6 Western blot

The proteins from brain tissues of rats extracted by RIPA lysis buffer (89900, Thermo Fisher Scientific, Inc., Waltham, MA, USA) were separated onto 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA). After blocked by skim milk, the membranes were incubated with primary antibodies at 4 °C for overnight. Next, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (ab7090, 1:2000, Abcam) for 1 h. Lastly, the chemiluminescence detection kit (89880, Thermo Fisher Scientific, Inc., Waltham, MA, USA) was utilized for the evaluation of the protein bands. The primary antibodies used in this study included: anti-HOMER1A (1:1000, ab184955, Abcam, Shanghai, China), anti-p-NF-κB p65 (1:1000, ab239882, Abcam), anti- nuclear factor kappa-B (NF-κB) p65 (0.5 μg/mL, ab16502, Abcam), anti-Iba1 (1 μg/mL, ab5076, Abcam), anti-CD16 (1:1000, ab211151, Abcam), anti-iNOS (1:1000, ab178945, Abcam), anti-CD206 (1 μg/mL, ab64693, Abcam), anti-Arg1 (1:1000, ab96183, Abcam), anti-p-AMPK (1:1000, ab131357, Abcam), anti-AMPK (1:1000, ab32047, Abcam), anti-TXNIP (1:1000, ab188865, Abcam), anti-P2RY12 (1:2000, ab184411, Abcam), anti-TMEM119 (1:1000, ab209064, Abcam) and anti-β-actin (1 μg/mL, ab8226, Abcam).

2.7 Immunofluorescence (IF) assay

The deparaffinized brain tissue sections were rehydrated. After washed with phosphate buffered saline (PBS), the antigen retrieval of sections was conducted through 0.1 M sodium citrate. Next, the sections were incubated with anti-Iba1, anti-GFAP, anti-MBP antibodies for overnight at 4 °C. After rinsed with PBS, the sections were incubated with fluorescence-labeled secondary antibodies. The nuclear was stained with 4,6-diamino-2-phenyl indole (DAPI), and the immunoreactivity was assessed through a fluorescence microscope (BX53T-32P01, Olympus, Tokyo, Japan).

2.8 TUNEL assay

The cell apoptosis was measured in brain tissues by using the in situ Cell Death Detection kit (11684817910, Roche, Basel, Switzerland). After staining, the images were randomly acquired in 5 fields under a fluorescence microscope (E200, Nikon, Tokyo, Japan). The cell apoptosis was evaluated by TUNEL-positive cells (%).

2.9 Flow cytometry

The Annexin V-FITC/PI Apoptosis Detection Kit (40302ES60, YEASEN, Shanghai, China) was used to examine the cell apoptosis according to the manufacturer’s protocol. The brain tissue single-cell suspensions were incubated on ice for 0.5 h with the corresponding antibodies: CD16 (PE, 12-0161-82, eBioscience, USA), Iba1 antibody (Alexa Fluor® 568, ab221003, Abcam, UK) and arginase 1 (Alexa Fluor 700, 12-0161-82, eBioscience, USA). Next, Annexin V-FITC and PI were mixed with cell suspension for 15 min in dark. At last, cells were analyzed through flow cytometer (BD FACSAria II, BD, Franklin Lake, NJ, USA).

2.10 Statistical analysis

The data were displayed as mean ± standard deviation (SD). The SPSS 19.0 software (SPSS Inc., Chicago, IL, USA) was used for statistical analysis. Comparisons among groups (two or more) were done through the student’s t-test or one-way analysis of variance (ANOVA) analysis. The p < 0.05 was set as statistically significant.

3.1 HOMER1A exhibited lower expression in the brain tissues of SEV-mediated rats

The schematic of the timeline was showed in Fig. 1A. Rats were treated with SEV (2% for 5 h) at Day 0, and rats were killed at Day 5 to collect the blood and tissues for following experiments. As displayed in Fig. 1B, compared with the Sham group, the brain tissues of SEV-treated rats were severely damaged, and showed the increased number of dead cells with cytoplasm atrophy and nuclear degeneration. In addition, through TUNEL assay, cell apoptosis was enhanced by SEV treatment (Fig. 1C). Additionally, the levels of S-100β and NSE were markedly elevated after SEV treatment (Fig. 1D). The mRNA and protein expressions of HOMER1A were reduced in the SEV group (Fig. 1E,F). These data indicated that HOMER1A exhibited lower expression in the brain tissues of SEV-mediated rats.

Fig. 1.HOMER1A exhibited lower expression in the brain tissues of SEV-induced rats. (A) The schematic of the timeline was showed. SEV (2% for 5 h) was treated to rats at Day 0, and rats were killed at Day 5 to collect the blood and tissues for next experiments. (B) The damage of brain tissues in rats was detected in the Sham and SEV groups through H&E staining. (C) The cell apoptosis was measured in the Sham and SEV groups through TUNEL staining. (D) The levels of S-100β and NSE were assessed through ELISA. (E,F) The mRNA and protein expressions of HOMER1A were examined through RT-qPCR and western blot. Six rats were used in each group. ***p < 0.001. SEV: Sevoflurane; NSE: neuron-specific enolase.

3.2 HOMER1A ameliorated nerve injury and cognitive deficit in SEV-treated rats

The schematic of the timeline was showed in Fig. 2A. AAV-NC or AAV-HOMER1A was injected into the rats. Rats were treated with SEV (2% for 5 h) at Day 0, and the MVM test was done at day 2–5, and then rats were sacrificed at Day 5 to collect the blood and tissues for following experiments. Moreover, through IF assay, it was revealed that AAV-HOMER1A preferentially targeted astrocytes (GFAP) and microglia (IBA1) (Supplementary Fig. 1). The HOMER1A protein expression was up-regulated after overexpressing HOMER1A (Fig. 2B). Moreover, the damage of brain tissues was relieved after HOMER1A overexpression in SEV-treated rats, but not changed in the Sham rats (Fig. 2C). Additionally, the TUNEL positive cells were decreased after HOMER1A overexpression in SEV-treated rats, but not changed in the Sham rats (Fig. 2D). The levels of S-100β and NSE were reduced after HOMER1A overexpression in SEV-treated rats, but not changed in the Sham rats (Fig. 2E). The mRNA expressions of ApoE4 and Clec7a were both decreased after HOMER1A overexpression in SEV-treated rats, but not changed in the Sham rats (Fig. 2F). Similarly, we also discovered that the escape latency(s) was decreased, and the clutter level of path, time in target quadrant(s), number of platform crossings, distance covered in the target quadrant were all increased after overexpressing HOMER1A in SEV-treated rats, but not changed in the Sham rats (Fig. 2G). Taken together, HOMER1A ameliorated nerve injury and cognitive deficit in SEV-treated rats.

Fig. 2.HOMER1A ameliorated nerve injury and cognitive deficit in SEV-induced rats. (A) The schematic of the timeline was showed. 3 days ago, AAV-NC or AAV-HOMER1A was injected into the rats. SEV (2% for 5 h) was treated to rats at Day 0, the MVM test was done at Day 2–5, and rats were killed at Day 5 to collect the blood and tissues for next experiments. Groups were divided into the Sham + AAV-NC, Sham + AAV-HOMER1A, SEV + AAV-NC and SEV + AAV-HOMER1A group. (B) The protein expression of HOMER1A was measured through western blot. (C) The damage of brain tissues was evaluated through H&E staining. (D) The cell apoptosis was examined through TUNEL assay. (E) The S-100β and NSE levels were tested through ELISA. (F) The mRNA expressions of ApoE4 and Clec7a were detected through RT-qPCR. (G_1–3) The Escape latency, Clutter level of path, Time in target quadrant, Number of platform crossings, Distance covered in the target quadrant were assessed through Morris water maze test. Six rats were used in each group. *p < 0.05, **p < 0.01 and ***p < 0.001. SEV: Sevoflurane; AAV: adeno-associated virus.

3.3 HOMER1A improved inflammation in the brain tissues of SEV-induced rats

Further experiments from RT-qPCR and ELISA demonstrated that the levels of TNF-α, IL-6 and IL-1β were enhanced after SEV treatment and their levels were decreased after overexpressing HOMER1A in SEV-induced rats, but not changed in the Sham rats (Fig. 3A,B). In addition, the NF-κB/p65 pathway (associated with inflammation) was assessed. Results uncovered that the expressions of p-NF-κB p65/NF-κB p65 were up-regulated after SEV treatment, and their levels were down-regulated after HOMER1A overexpression in SEV-induced rats, but not changed in the Sham rats (Fig. 3C). To sum up, HOMER1A improved inflammation in the brain tissues of SEV-induced rats.

Fig. 3.HOMER1A improved inflammation in the brain tissues of SEV-induced rats. (A) The TNF-α, IL-6 and IL-1β mRNA expressions were measured through RT-qPCR. (B) The TNF-α, IL-6 and IL-1β levels were detected through ELISA. (C) The expression of p-NF-κB p65/NF-κB p65 was tested through western blot. Six rats were used in each group. *p < 0.05, **p < 0.01 and ***p < 0.001. SEV: Sevoflurane; AAV: adeno-associated virus; TNF-α: tumor necrosis factor-α; IL-6: Interleukin-6; IL-1β: Interleukin-1β.

3.4 HOMER1A reduced SEV-stimulated microglial activation

Next, through IF assay, it was demonstrated that the Iba1 level was obviously strengthened after SEV treatment and the Iba1 level was weakened after HOMER1A overexpression in SEV-induced rats, but not changed in the Sham rats (Fig. 4A). Furthermore, the M1 (Iba1⁺ CD16⁺) cells were increased after treated with SEV, and they were decreased after HOMER1A overexpression in SEV-induced rats, but not changed in the Sham rats. The M2 (Iba1⁺ Arg1⁺) cells were increased after treating with SEV and they were further increased after HOMER1A overexpression in SEV-induced rats, but not changed in the Sham rats (Fig. 4B). The Iba1, CD16, iNOS (M1-like marker), CD206 and Arg1 (M2-like marker) expressions were all enhanced after cells treated with SEV. The Iba1, CD16, iNOS (M1-like marker) expressions were reduced, but CD206 and Arg1 (M2-like marker) expressions were further increased after HOMER1A overexpression in SEV-induced rats, but not changed in the Sham rats (Fig. 4C). Additionally, the protein expressions of P2RY12 and TMEM119 were decreased after HOMER1A overexpression in SEV-induced rats, but not changed in the Sham rats (Fig. 4D). These findings disclosed that HOMER1A reduced SEV-stimulated microglial activation.

Fig. 4.HOMER1A reduced SEV-induced microglial activation. Groups were divided into the Sham + AAV-NC, Sham + AAV-HOMER1A, SEV + AAV-NC and SEV + AAV-HOMER1A group. (A) The Iba1 level was evaluated through IF assay. (B) The M1 (Iba1⁺ CD16⁺) and M2 (Iba1⁺ Arg1⁺) cells were confirmed through flow cytometry. (C) The Iba1, CD16, iNOS (M1-like marker), CD206 and Arg1 (M2-like marker) expressions were assessed through western blot. (D) The protein expressions of P2RY12 and TMEM119 were evaluated through western blot. Six rats were used in each group. **p < 0.01, ***p < 0.001. SEV: Sevoflurane; AAV: adeno-associated virus.

3.5 HOMER1A stimulated AMPK/TXNIP activation

As shown in Fig. 5A, the protein level of p-AMPK/AMPK was down-regulated after SEV treatment and its level was up-regulated after overexpressing HOMER1A in SEV-induced rats, but not changed in the Sham rats. The TXNIP protein expression was enhanced after SEV treatment, and its level was reduced after HOMER1A overexpression in SEV-induced rats, but not changed in the Sham rats. Additionally, the decreased expression of TXNIP mediated by HOMER1A overexpression in SEV-induced rats was reversed by CC (20 mg/kg, AMPK inhibitor) treatment (Fig. 5B). In short, HOMER1A activated AMPK pathway to reduce TXNIP expression.

Fig. 5.HOMER1A stimulated AMPK/TXNIP activation. (A) The p-AMPK/AMPK and TXNIP levels were examined in the Sham + AAV-NC, Sham + AAV-HOMER1A, SEV + AAV-NC and SEV + AAV-HOMER1A groups through western blot. (B) The TXNIP expression was tested in the Sham, SEV + AAV-NC, SEV + AAV-HOMER1A and SEV + AAV-HOMER1A + CC (AMPK inhibitor) groups through western blot. Six rats were used in each group. ***p < 0.001. SEV: Sevoflurane; AAV: adeno-associated virus.

3.6 Inhibition of AMPK activation attenuated the neuroprotective effects of HOMER1A

The reduced levels S-100β and NSE mediated by HOMER1A overexpression were rescued after treating with CC (Fig. 6A). Besides, HOMER1A overexpression down-regulated TNF-α, IL-6 and IL-1β mRNA expressions, but this effect was restored by adding with CC (Fig. 6B). The decreased expressions of Iba1, CD16, iNOS, as well as the increased expression of CD206, Arg1 mediated by HOMER1A overexpression were reversed by CC treatment (Fig. 6C). Moreover, the decreased escape latency(s) was, and the increased clutter level of path, time in target quadrant(s), number of platform crossings, distance covered in the target quadrant mediated by HOMER1A overexpression were rescued after CC treatment (Supplementary Fig. 2). In addition, the decreased M1 (Iba1⁺ CD16⁺) cells, and the increased M2 (Iba1⁺ Arg1⁺) cells stimulated by HOMER1A overexpression were offset after CC addition (Supplementary Fig. 3). In general, inhibition of AMPK activation attenuated the neuroprotective effects of HOMER1A.

Fig. 6.Inhibition of AMPK activation attenuated the neuroprotective effects of HOMER1A. Groups were divided into the Sham, SEV + AAV-NC, SEV + AAV-HOMER1A and SEV + AAV-HOMER1A + CC (AMPK inhibitor) group. (A) The S-100β and NSE levels were assessed through ELISA. (B) The TNF-α, IL-6 and IL-1β mRNA expressions were examined through RT-qPCR. (C) The Iba1, CD16, iNOS (M1-like marker), CD206 and Arg1 (M2-like marker) expressions were tested through western blot. Six rats were used in each group. ***p < 0.001. SEV: Sevoflurane; AAV: adeno-associated virus; TNF-α: tumor necrosis factor-α; IL-6: Interleukin-6; IL-1β: Interleukin-1β.