Title
Author
DOI
Article Type
Special Issue
Volume
Issue
Dioscin alleviates cardiomyocyte pyroptosis in acute myocardial infarction rats via regulating LncRNA FGD5-AS1/miR-424/HOXA3 axis
1Department of Cardiology, The Second Affiliated Hospital of Chengdu Medical College, Nuclear Industry 416 Hospital, 610051 Chengdu, Sichuan, China
*Corresponding Author(s):wuqi8371157@126.com (Qi Wu)
† These authors contributed equally.
| History | Submitted: 02 July 2024 | Accepted: 06 August 2024 | Published: 08 November 2024 |
| Copyright: | ©2024 The Author(s). Published by MRE Press. |
Acute myocardial infarction (AMI) is a severe cardiovascular condition. Recently, it has been discovered that dioscin plays pivotal roles in the domains of anti-inflammatory, antiviral, and anti-tumor activities. However, Nevertheless, the precise impact and mechanism by which dioscin protects against cardiomyocyte pyroptosis in AMI remains unclear. This study aimed to determine the significance and investigate the mechanisms by which dioscin affects cardiomyocyte pyroptosis in cases of acute myocardial infarction. In this study, rats were divided into four distinct groups: sham, AMI, AMI + Negative Control (NC), and AMI + FGD5 Antisense RNA 1 (FGD5-AS1). Subsequently, quantitative real-time polymerase chain reaction (qPCR) assay, quantification of infarct size, and enzyme linked immunosorbent assay (ELISA) assay were used to confirm the expression of FGD5-AS1 after AMI surgeries. The results indicated that, expression of FGD5-AS1 was significantly decreased. Furthermore, it was determined that FGD5-AS1 can alleviate myocardial damage induced by AMI. Methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay and western blot assay results indicated that FGD5-AS1 promoted cell proliferation and decreased the inflammatory response and pyroptosis of cardiomyocytes induced by hypoxia/re-oxygenation (H/R). In addition, a combination of bioinformatics approaches, dual-luciferase reporter assay, and RNA pull down assay were used to predict and confirm the interaction between FGD5-AS1, microRNA-424 (miR-424), and Homeobox A3 (HOXA3). It was observed that FGD5-AS1 facilitates cell proliferation and alleviate H/R-induced inflammatory response and cardiomyocyte pyroptosis by regulating HOXA3 expression. Finally, the confirmation of dioscin’s ability to mitigate myocardial damage and cardiomyocyte pyroptosis resulting from acute myocardial infarction (AMI) and regulating the expression of FGD5-AS1/miR-424/HOXA3 axis was established. Together, this research demonstrates that dioscin effectively reduces cardiomyocyte pyroptosis in rats with acute myocardial infarction (AMI) by modulating long non-coding RNA (LncRNA) FGD5-AS1/miR-424/HOXA3 axis.
Cite this article
Songjie Bi, Wei Chen, Qi Wu, Hong Yang, Meng Jia, Chunmei Liu. Dioscin alleviates cardiomyocyte pyroptosis in acute myocardial infarction rats via regulating LncRNA FGD5-AS1/miR-424/HOXA3 axis. Signa Vitae. 2024; 20(11): 91-102. doi: 10.22514/sv.2024.149
1. Introduction
Acute myocardial infarction (AMI) remains the most serious cardiac event, although mortality have steadily declined over the past few years [1, 2]. Inflammatory response and cardiomyocyte pyroptosis are the main features of acute myocardial infarction, and play a vital role in myocardial dysfunction and heart failure [3, 4]. Thus, understanding the molecular process of cell death (apoptosis) and the body’s immune response (inflammatory response) in myocardial cells can provide new insights and treatment options for AMI therapy [5, 6].
Dioscin is a natural steroidal saponin that is commonly found in plants belonging to the diosgenaceae family [7]. Multiple studies have demonstrated that dioscin possesses anti-tumor properties [8]. Furthermore, research has indicated that dioscin can induce DNA damage [9], activate the mitochondrial signaling pathway and cause cell apoptosis, and effectively combat lung cancer [10]. Nevertheless, there is currently no available information on the impact of dioscin on acute myocardial infarction, and the precise molecular mechanism and pharmacodynamics underlying the anti-pyroptosis activity of dioscin on cardiomyocytes remains unexplored.
LncRNAs refer to endogenous cellular RNAs that are not involved in coding for proteins. Although lncRNAs cannot be used as templates for protein synthesis, they have been shown to play a crucial role in numerous cardiovascular disorders [11, 12]. LncRNA cardiac hypertrophy-related factor (LncRNA CHRF) has been reported to be involved in cardiomyocyte function and promote cardiac hypertrophy through miR-93 regulation of AKT serine/threonine kinase 3 (AKT3) [13]. Downregulation of antisense noncoding RNA in the INK4 locus (ANRIL) can reduce cardiomyocyte apoptosis in AMI by regulating interleukin-33 (IL-33)/suppression of tumorigenicity 2 (ST2) [14]. Pro-cardiac fibrotic lncRNA (PCFL) promotes myocardial fibrosis after myocardial infarction through miR-378/growth factor receptor bound protein 2 (GRB2) pathway [15]. Furthermore, Shen et al. [16] suggested that the expression of FGD5-AS1 was reduced in individuals with acute myocardial infarction. This finding indicates that FGD5-AS1 could serve as a novel regulatory marker for acute myocardial infarction, as revealed through the study of important mRNAs and lncRNAs using integrated network analysis [16].
FGD5-AS1, also known as FGD5 antisense RNA 1, a novel long-stranded non-coding RNA, has been reported to be decreased in the oxygen glucose deprivation/re-oxygenation (OGD/R) model of nerve cells, and overexpression can facilitate the survival of nerve cells, reduce apoptosis and play a neuroprotective role [17]. FGD5-AS1 expression is also reduced in periodontitis and lipopolysaccharides (LPS)-induced periodontal ligament cells (PDLCS) cells, and upregulation can reduce LPS-induced inflammation by miR-142-3p/suppressor of cytokine signaling 6 (SOCS6)/nuclear factor kappa-B (NF-κB) signaling [18]. However, the role and mechanism of FGD5-AS1 in myocardial infarction injury is still unknown. StarBase predicted that FGD5-AS1 could bind to miR-424 and miR-424 can regulate cardiomyocyte pyrolysis and promote myocardial ischemia/reperfusion injury. In addition, StarBase predicted that miR-424 could target HOXA3, and HOXA3 indirectly regulated myocardial apoptosis through transcriptional inhibition of NOD-like receptor thermal protein domain associated protein 3 (NLRP3) expression. This study mainly explored the effect of lncRNA FGD5-AS1 on myocardial infarction through miR-424/HOXA3 by dioscin.
2. Materials and methods
2.1 Animals
8 weeks old male Sprague-Dawley rats (245–275 g) were provided by SIPPR-Bk Laboratory Animals Co. Ltd. (Shanghai, China). All the protocols used were ratified by the Animal Ethics Committee of the Second Affiliated Hospital of Chengdu Medical College in accordance with the National Institutes of Health Laboratory Animal Care and Use Guidelines [19]. Each rat was fed 5 g/100 g of fresh dry feed and about 10 mL/100 g of acidified water with a pH of 2.5–2.8 per day. The duration of light exposure was 12 hours per day, and the rats were prevented from being stimulated by bright light (Approval No. 20230137).
2.2 AMI rat administration
Twenty-four Sprague–Dawley rats were divided randomly into four groups: sham, AMI, AMI + NC, and AMI + FGD5-AS1, (n = 6). Rats in the AMI groups underwent surgery to cause AMI [20]. On the first day post AMI treated by surgical ligation of the left anterior descending coronary artery, rats in AMI + NC and AMI + FGD5-AS1 groups were treated intravenously. Briefly, LncRNA FGD5-AS1 and NC (GenePharma, Shanghai, China) were intravenously injected into the tail vein of the rats. On the first day after AMI treated by surgical ligation of the left anterior descending coronary artery, rats in AMI and AMI + dioscin groups were treated intravenously. Briefly, dioscin (100 mg/kg) and equal volume of 0.9% saline were intravenously injected into the tail vein of rats, respectively.
2.3 qPCR
The expression of LncRNA FGD5-AS1, miR-424, and HOXA3 were detected using SYBR Premix EX Taq (RR390Q, Takara, Kusatsu, Japan). The relative expression of LncRNA FGD5-AS1, miR-424, and HOXA3 were analyzed by the 2−ΔΔCt method. Primer sequences are shown in Table 1.
| Gene | Primer | Sequence (5′ → 3′) |
| FGD5 Antisense RNA 1 | ||
| Forward | AGAAGCGGAGGGGTGAAAAT | |
| Reverse | CCGCCTTATAGTTGGCCCTC | |
| microRNA-424 | ||
| Forward | GCAGCAGCAATTCATGTTT | |
| Reverse | GTGCAGGGTCCGAGGT | |
| Homeobox A3 | ||
| Forward | CACGCGGAGCGAAACAGT | |
| Reverse | CAGTCCTCCGTTTGCTGG | |
| β-actin | ||
| Forward | GTGACGTTGACATCCGTAAAGA | |
| Reverse | GCCGGACTCATCGTACTCC |
2.4 Quantification of infarct size (2,3,5,Triphenyl-2H-Tetrazolium Chloride staining)
The obtained myocardial tissues were cut into 3 mm slices and incubated with 2% TTC solution. Then, the slices were fixed with 8% formalin and photographed. The infarct size was quantified by ImageJ (1.53a, National Institutes of Health, Montgomery Village, MD, USA).
2.5 ELISA
For detecting the lactate dehydrogenase (LDH), IL-1β and IL-18 protein levels, ELISA kits (LDH kit, ab102526, Abcam, Waltham, MA, USA; IL-1β kit, ab100767, Abcam, Waltham, MA, USA; IL-18 kit, ab213909, Abcam, Waltham, MA, USA) were used. The production of LDH, IL-1β and IL-18 in the serum of rats were detected following the manufacturer’s instructions.
2.6 Cell culture
Rat cardiomyocyte H9C2 were purchased from the Chinese Academy of Sciences (Shanghai, China). The cells were cultured in Dulbecco’s modified eagle medium (DMEM) (11965092, Gibco, Carlsbad, CA, USA) with 10% fetal bovine serum (FBS), and 1% p/s in incubator.
2.7 Cell administration
Rat cardiomyocyte H9C2 were seeded in serum-free medium and exposed to hypoxia condition in incubator with 5% carbon dioxide and 95% nitrogen or normoxia condition in 5% carbon dioxide and 95% oxygen. On the first day post H/R treatment, Rat cardiomyocyte H9C2 in H/R and H/R + dioscin groups were treated by adding supplements to the culture medium. Briefly, dioscin (2 µg/mL) and equal volume of DMSO were added into the culture medium, respectively.
2.8 Cell transfection
The synthetic LncRNA FGD5-AS1, miR-424 mimics, NC mimics (control), miR-424 inhibitor, NC inhibitor (control) and HOXA3-targeting short hairpin RNA (shRNA) oligonucleotide sequences were acquired from GenePharma (Shanghai, China). LncRNA FGD5-AS1 and NC were transfected into cells by Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA).
2.9 MTT assay
Cells in 96-well plates were incubated for 4 h with 0.6 mg/mL MTT solution (C0009S, Beyotime, Shanghai, China). Subsequently, the culture medium was replaced by 100 µL dimethyl sulfoxide (DMSO, D8418, Sigma-Aldrich, St. Louis, MO, USA) to visualize. The optical density was detected at 490 nm by microplate reader (Epoch 2, BioTek, Winooski, VT, USA).
2.10 Western blot
Briefly, radio immunoprecipitation assay (RIPA) lysis buffer (P0013B, Beyotime, Shanghai, China) was applied to extract the total protein from cells (Beyotime, Shanghai, China). Bicinchoninic acid assay (BCA) kit (CW00145, CoWin Biotechnology, Jiangsu, China) was used to determine the concentration of protein, which was then electrophoresed to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Then, protein was transferred to the polyvinylidene difluoride (PVDF) membranes followed by non-fat milk. The membranes were incubated with specific primary antibodies NOD-like receptor thermal protein domain associated protein 3 (NLRP3, ab214185, 1:2500, Abcam, Waltham, MA, USA), apoptosis associated speck like protein containing a CARD (ASC, ab180799, 1:2500, Abcam, Waltham, MA, USA), cleaved caspase-1 (ab62698, 1:3000, Abcam, Waltham, MA, USA), gasdermin (GSDMD-N, ab219800, 1:3000, Abcam, Waltham, MA, USA), HOXA3 (ab230879, 1:3000, Abcam, Waltham, MA, USA), glyceraldehyde-3-phosphate dehydrogenase (GAPDH, ab9485, 1:2000, Abcam, Waltham, MA, USA), and β-actin (ab8227, 1:2500, Abcam, Waltham, MA, USA) overnight at 4 °C. Afterwards, the membranes were further incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (ab205718, 1:3000, Abcam, Waltham, MA, USA). The samples were normalized by β-actin and analysed using ImageJ software.
2.11 Dual-luciferase reporter assay
The fragments of 3′-UTRs of FGD5-AS1 or HOXA3 mRNA binding sites of miR-424 were cloned into pmirGLO luciferase report vector (E1330, Promega, Madison, WI, USA). MiR-424 mimics and NC mimics were co-transfected with reporter plasmids into cells by Lipofectamine 2000. After two days of transfection, the luciferase activity was detected by the dual-luciferase kit (E1910, Promega, Madison, WI, USA).
2.12 RNA pull-down assay
FGD5-AS1 sense and NC (control) probes coupled with biotin were synthesized by GenePharma (Shanghai, China). Cells were treated in RNA immunoprecipitation lysis buffer with streptavidin coated magnetic beads. Subsequently, the lysates were incubated with probe-coated magnetic beads and washed using wash buffer. qPCR was applied to check miR-424 expression in the RNA complex bound to the beads.
2.13 Statistical analysis
All data are demonstrated as the mean ± standard error of the mean from 6 independent repeats. Comparisons among different groups with one independent variable were performed using one-way analysis of variance (ANOVA) and comparisons among different groups with two independent variables were performed using two-way ANOVA.
3. Results
3.1 FGD5-AS1 alleviates myocardial damage caused by acute myocardial infarction
The expression of LncRNA FGD5-AS1 was assessed in order to examine the correlation between FGD5-AS1 and AMI. The findings demonstrated a significant decrease in the expression of FGD5-AS1 following AMI surgeries. Nevertheless, the rats that received intravenous injection of FGD5-AS1 exhibited a noticeable increase in the expression of FGD5-AS1, suggesting that the intravenous injection effectively up-regulated the expression level of FGD5-AS1 (Fig. 1A). Next, the impact of FGD5-AS1 on acute myocardial infarction (AMI) was evaluated by measuring the size of infarcted tissue in rats. The results demonstrated a clear increase in infarction volume due to AMI therapy. Nevertheless, the excessive expression of FGD5-AS1 significantly decreased the volume of infarction, as depicted in (Fig. 1B). In addition, ELISA was employed to assess the protein expression of lactate dehydrogenase (LDH) in rats, in order to investigate the impact of FGD5-AS1 on the mitigation of cardiac damage. The ELISA results indicated a significant rise in the protein expression level of LDH in the AMI group. FGD5-AS1 clearly reduced the protein expression of LDH, as seen in (Fig. 1C). These results proved that FGD5-AS1 mitigates myocardial damage caused by acute myocardial infarction.
Fig. 1.FGD5-AS1 alleviates myocardial damage caused by acute myocardial infarction. (A) The mRNA expression levels of FGD5-AS1 in rats in each group. (B) Infarction volume was assessed to check protective effect of FGD5-AS1 on AMI rats in each group. (C) The protein expression levels of LDH of rats in each group. Data were presented as the mean ± SD with three independent experiments. **p < 0.01 versus sham group, #p < 0.05, and ##p < 0.01 versus AMI + NC group. AMI: Acute myocardial infarction; LDH: lactate dehydrogenase; FGD5-AS1: FGD5 Antisense RNA 1; NC: Negative control.
3.2 FGD5-AS1 reduces H/R-induced cardiomyocyte pyroptosis
In this study, cardiomyocytes H9C2 were selected to study the regulatory role of FGD5-AS1 on AMI. Compared with cells cultured under normal condition, cells cultured under H/R condition had lower expression level of FGD5-AS1. FGD5-AS1 or NC were transfected into H9C2 and cultured under H/R conditions. The expression of FGD5-AS1 in the cells transfected with FGD5-AS1 was significantly elevated, suggesting that the transfection successfully up-regulated the expression of FGD5-AS1 (Fig. 2A). Subsequently, the MTT test was utilized to evaluate the impact of FGD5-AS1 on the cellular proliferation of H9C2. The findings suggested that H/R treatment significantly suppressed cell proliferation, whereas FGD5-AS1 greatly enhanced the cell proliferation capacity of H9C2 (Fig. 2B).
Subsequently, ELISA was utilized to assess the protein expression of inflammation-related factors (IL-18 and IL-1β) in H9C2 cells that overexpressed FGD5-AS1, in order to evaluate the inflammatory response. The results indicated that the protein expression of IL-18 and IL-1β was significantly increased in the H/R group, whereas it was significantly decreased in the FGD5-AS1 group. This suggests that FGD5-AS1 can minimize the inflammatory response (Fig. 2C). Furthermore, western blot analysis was conducted to examine inflammation and cell pyroptosis-related proteins. The findings indicated that the H/R treatment significantly increased the expression of NLRP3, ASC, cleaved caspase-1, and GSDMD-N. Conversely, the overexpression of FGD5-AS1 notably reduced the levels of these inflammation and cell pyroptosis-related proteins (Fig. 2D). These results suggested FGD5-AS1 reduces H/R-induced cardiomyocyte pyroptosis.
Fig. 2.FGD5-AS1 reduces H/R-induced cardiomyocyte pyroptosis. (A) The mRNA expression levels of FGD5-AS1 of H9C2 in each group. (B) Cell proliferation ability of H9C2 was detected using MTT assay. (C) The protein expression levels of IL-18 and IL-1β of H9C2 in each group. (D) Western blot was applied to detect inflammation and cell pyroptosis-related proteins in H9C2 in each group. Data were presented as the mean ± SD with three independent experiments. **p < 0.01 versus control group, #p < 0.05, and ##p < 0.01 versus H/R + NC group. FGD5-AS1: FGD5 Antisense RNA 1; MTT: methylthiazolyldiphenyl-tetrazolium bromide; IL-18: interleukin-18; IL-1β: interleukin-1β; H/R: hypoxia/re-oxygenation; NC: Negative control; NLRP3: NOD-like receptor thermal protein domain associated protein 3; ASC: apoptosis associated speck like protein containing a CARD; GSDMD-N: gasdermin; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
3.3 FGD5-AS1 targets miR-424 expression
To explore the biomechanism of FGD5-AS1 in AMI, the mRNA binding sites were anticipated in StarBase (https://rnasysu.com/encori/). The results suggested that lncRNA FGD5-AS1 was a target of miR-424. The forecasted 3′-UTRs of FGD5-AS1 binding to miR-424 is presented in (Fig. 3A). The findings validated that the increased expression of miR-424 significantly decreased the luciferase activity of the FGD5-AS1-wt reporter gene, as shown in (Fig. 3B). To further attest whether FGD5-AS1 regulated miR-424 expression, RNA pulldown assay was conducted. The results proved that miR-424 was significantly enriched in FGD5-AS1 group than NC group (Fig. 3C). Additionally, a qPCR test was utilized to elucidate the correlation between FGD5-AS1 and miR-424. Cells cultured under H/R condition had higher expression levels of miR-424. However, the expression of miR-424 in the cells transfected with FGD5-AS1 was significantly decreased, suggesting that FGD5-AS1 has the ability to regulate the expression of miR-424 (Fig. 3D).
Fig. 3.FGD5-AS1 targets miR-424 expression. (A) Forecast of miR-424 binding sites on target gene FGD5-AS1 by StarBase. (B) Dual-luciferase assays were carried out after cells were co-transfected FGD5-AS1-wt or FGD5-AS1-mut with miR-424 mimics and NC mimics (control), respectively. (C) RNA pulldown experiment showed that miR-424 was significantly enriched for FGD5-AS1. (D) The mRNA expression levels of miR-424 of H9C2 in each group. Data were presented as the mean ± SD with three independent experiments. **p < 0.01 versus control group and ##p < 0.01 versus H/R + NC group. FGD5-AS1: FGD5 Antisense RNA 1; NC: Negative control; H/R: hypoxia/re-oxygenation.
3.4 FGD5-AS1 regulates HOXA3 expression by targeting miR-424
The mRNA binding sites were forecasted in StarBase once more to find out the binding target of miR-424. The results indicated that HOXA3 was a target of miR-424. The forecasted 3′-UTRs of HOXA3 mRNA binding to miR-424 is presented in (Fig. 4A). The results confirmed the overexpression of miR-424 markedly reduced the luciferase activity of the HOXA3-wt reporter gene (Fig. 4B). The findings indicated that the introduction of miR-424 mimics significantly suppressed the expression of HOXA3 mRNA and protein. Conversely, the use of a miR-424 inhibitor noticeably increased the production of HOXA3 mRNA and protein (Fig. 4C,D). To further prove whether FGD5-AS1 regulates HOXA3 expression by targeting miR-424, the expression of HOXA3 protein was checked in the three types of cells, including H9C2 transfected NC + NC mimics, FGD5-AS1+ NC mimics, and FGD5-AS1+ miR-424 mimics. Western blot results indicated that FGD5-AS1 significantly enhanced the expression of HOXA3 protein, while miR-424 mimics strongly inhibited the expression of BCL2L13 protein (Fig. 4E). These data suggested that FGD5-AS1 regulates HOXA3 expression by specifically targeting miR-424.
Fig. 4.FGD5-AS1 regulates HOXA3 expression by targeting miR-424. (A) Forecast of miR-424 binding sites on target gene HOXA3 by StarBase. (B) Dual-luciferase assays were carried out after cells were co-transfected HOXA3-wt or HOXA3-mut with miR-424 mimics and NC mimics (control), respectively. (C,D) The mRNA and protein expression levels of HOXA3 in H9C2 in each group. (E) The protein expression levels of HOXA3 in H9C2 in each group. Data were presented as the mean ± SD with three independent experiments. **p < 0.01 versus control group and ##p < 0.01 versus H/R + NC group. HOXA3: Homeobox A3; NC: Negative control; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; FGD5-AS1: FGD5 Antisense RNA 1.
3.5 FGD5-AS1 alleviates H/R-induced cardiomyocyte pyroptosis by regulating HOXA3 expression
MTT assay was utilized to detect cell proliferation of H9C2. Prior MTT assays have demonstrated that H/R treatment dramatically suppressed cell proliferation, whereas FGD5-AS1 greatly enhanced the cell proliferation of H9C2. Nevertheless, the cell proliferation of H9C2 with suppressed HOXA3 expression significantly decreased. Remarkably, the growth and division of H9C2 cells with suppressed HOXA3 gene expression significantly increased following the introduction of FGD5-AS1 by transfection (Fig. 5A). Subsequently, the expression level of inflammation-related factors (IL-18 and IL-1β) were assessed by ELISA to check the influence of FGD5-AS1 on H9C2 through HOXA3. Previous ELISA assay has showed that the protein expression of IL-18 and IL-1β were significantly increased in the H/R group, while the protein expression of IL-18 and IL-1β were significantly decreased in the FGD5-AS1 group.
Nevertheless, the protein expression levels of IL-18 and IL-1β were significantly elevated in H9C2 cells with reduced HOXA3. Notably, the protein expression of IL-18 and IL-1β in HOXA3 knocked down H9C2 cells was significantly reduced following transfection with FGD5-AS1, as seen in (Fig. 5B). Furthermore, western blot analysis was conducted to examine inflammation and cell pyroptosis-related proteins. The findings demonstrated a significant increase in the expression of NLRP3, ASC, cleaved caspase-1, and GSDMD-N following H/R treatment. Conversely, the overexpression of FGD5-AS1 resulted in a substantial downregulation of these inflammation and cell pyroptosis-related proteins. Nevertheless, the levels of inflammation and cell pyroptosis-related proteins in HOXA3 knocked down H9C2 cells were significantly elevated. Notably, the levels of inflammation and cell pyroptosis-related proteins in HOXA3 knocked down H9C2 cells were significantly reduced following transfection with FGD5-AS1 (Fig. 5C). The data provided conclusive evidence that FGD5-AS1 mitigates cardiomyocyte pyroptosis produced by H/R by modulating the expression of HOXA3.
Fig. 5.FGD5-AS1 alleviates H/R-induced cardiomyocyte pyroptosis by regulating HOXA3 expression. (A) Cell proliferation ability of H9C2 was detected using MTT assay. (B) The protein expression of IL-18 and IL-1β of H9C2 in each group. (C) Western blot was applied to detect inflammation and cell pyroptosis-related proteins in H9C2 in each group. Data were presented as the mean ± SD with three independent experiments. *p < 0.05 and **p < 0.01 versus H/R group; ##p < 0.01 versus H/R + FGD5-AS1 group; &p < 0.05 and &&p < 0.01 versus H/R + shHOXA3 group. FGD5-AS1: FGD5 Antisense RNA 1; H/R: hypoxia/re-oxygenation; HOXA3: Homeobox A3; MTT: methylthiazolyldiphenyl-tetrazolium bromide; IL-18: interleukin-18; IL-1β: interleukin-1β; NC: Negative control; NLRP3: NOD-like receptor thermal protein domain associated protein 3; ASC: apoptosis associated speck like protein containing a CARD; GSDMD-N: gasdermin; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
3.6 Dioscin alleviates myocardial damage and cardiomyocyte pyroptosis caused by acute myocardial infarction
The impact of dioscin on acute myocardial infarction (AMI) was evaluated by measuring the volume of infarction in rats. The results demonstrated a clear enhancement in infarction volume due to AMI therapy. Nevertheless, dioscin significantly decreased the volume of infarction (Fig. 6A). In addition, ELISA was employed to assess the protein expression of LDH in rats in order to examine the impact of dioscin on the mitigation of myocardial damage. The ELISA results indicated a significant rise in the protein expression level of LDH in the AMI group. However, it is evident that dioscin significantly reduced the protein expression of LDH, as seen in (Fig. 6B). Subsequently, the MTT assay was utilized to assess the impact of dioscin on the cellular proliferation of H9C2. The findings suggested that the treatment with H/R significantly suppressed cell proliferation, but dioscin greatly enhanced the cell proliferation ability of H9C2 (Fig. 6C).
Subsequently, the ELISA findings suggested a significant increase in the protein expression of IL-18 and IL-1β in the H/R group. Conversely, the protein expression of IL-18 and IL-1β showed a notable decrease in the dioscin group, showing that dioscin has the ability to attenuate inflammatory response (Fig. 6D). In addition, inflammation and cell pyroptosis-related proteins were also analysed by western blot, and the results showed that H/R treatment markedly upregulated the expression of NLRP3, ASC, cleaved caspase-1, and GSDMD-N, while overexpression of dioscin significantly downregulated these inflammation and cell pyroptosis-related proteins (Fig. 6E,F). These results suggested that dioscin alleviates myocardial damage and reduces cardiomyocyte pyroptosis by AMI.
Fig. 6.Dioscin alleviates myocardial damage and cardiomyocyte pyroptosis caused by acute myocardial infarction. (A) Infarction volume was assessed to check protective effect of dioscin on AMI rats in each group. (B) The protein expression levels of LDH of rats in each group. (C) Cell proliferation ability of H9C2 was detected using MTT assay. (D) The protein expression levels of IL-18 and IL-1β of H9C2 in each group. (E) Western blot was applied to detect inflammation and cell pyroptosis-related proteins in H9C2 in each group. (F) Statistics of relative protein expression levels of inflammation and cell pyroptosis-related proteins in H9C2 in each group. Data were presented as the mean ± SD with three independent experiments. **p < 0.01 versus sham group, #p < 0.05, and ##p < 0.01 versus AMI + dioscin group. AMI: Acute myocardial infarction; LDH: lactate dehydrogenase; H/R: hypoxia/re-oxygenation; IL: interleukin; NLRP3: NOD-like receptor thermal protein domain associated protein 3; ASC: apoptosis associated speck like protein containing a CARD; GSDMD-N: gasdermin; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
3.7 Dioscin regulates the expression of FGD5-AS1/miR-424/HOXA3 axis
To further attest whether dioscin regulated FGD5-AS1/miR-424/HOXA3 expression, qPCR assay was conducted in both AMI rats and H9C2 cells. The findings demonstrated a notable drop in the expression level of FGD5-AS1 and HOXA3, while miR-424 increased significantly in the AMI or H/R group. However, the expression level of FGD5-AS1, miR-424, and HOXA3 was reversed after treatment with dioscin, suggesting that dioscin regulates the expression of FGD5-AS1/miR-424/HOXA3 axis (Fig. 7A,B).
Fig. 7.Dioscin regulates the expression of FGD5-AS1/miR-424/HOXA3 axis. (A,B) The mRNA expression levels of FGD5-AS1, miR-424, and HOXA3 of AMI rats and H9C2 in each group. Data were presented as the mean ± SD with three independent experiments. **p < 0.01 versus control group and ##p < 0.01 versus dioscin group. AMI: Acute myocardial infarction; FGD5-AS1: FGD5 Antisense RNA 1; HOXA3: Homeobox A3; H/R: hypoxia/re-oxygenation.
4. Discussion
Despite numerous remarkable advancements in modern medicine, the molecular pathways responsible for acute myocardial infarction (AMI) remain poorly comprehended. Recent investigations have indicated that dioscin has the potential to play a significant role in reducing inflammation and preventing cell death (apoptosis) [21]. Nevertheless, there is limited research on the effects of dioscin in AMI. Investigating the molecular regulation mechanism of dioscin in AMI could potentially provide new treatment targets for this condition. Furthermore, the precise molecular regulatory mechanism by which dioscin influences the determination of AMI destiny is still not well comprehended. Recent investigations have suggested that lncRNAs may have the capacity to play a crucial role in cell proliferation and intracellular trafficking [22]. However, there are few studies on lincRNAs in AMI, and understanding the mechanism of LncRNA FGD5-AS1 in AMI could potentially provide a novel therapeutic target for the treatment of AMI.
Dioscin has garnered significant interest in the medical domain in recent years. Traditionally, professionals frequently utilize it as a treatment for wound healing, hemostasis, inflammation reduction, and cancer prevention. Research has demonstrated that dioscin exhibits significant anti-tumor properties [23]. Several studies have demonstrated that dioscin has the ability to specifically target the activation of miR-149-3p expression, inhibit the AKT1/p53 signaling pathway, cause apoptosis of pancreatic cancer cells, and effectively combat pancreatic cancer [24]. Other studies have shown that dioscin can activate estrogen receptor estrogen receptor β and induce apoptosis of prostate cancer cells (PC3) and prostate stem cells [25]. Here, the results showed that dioscin alleviates myocardial damage and reduces cardiomyocyte pyroptosis by AMI. Further, we explored the specific biological mechanism of dioscin in alleviating pyroptosis in AMI rats.
LncRNA FGD5-AS1 is an endogenous cellular RNA that been confirmed to play a pathological role in many diseases. FGD5-AS1 has been found to impact the advancement of cardiovascular disorders and other ailments and found to promote the spread and growth of renal cell carcinoma through the extracellular regulated protein kinases (ERK)/AKT signaling pathway [26]. A recent study shown that the interaction between FGD5-AS1 and microRNA (miRNA)-223 reduces neuronal damage [17]. Furthermore, it has been revealed that FGD5-AS1 can mitigate the advancement of glioblastoma through the activation of the Wnt/β-catenin signaling pathway [27]. A review on the association between LncRNA FGD5-AS1 and cancer has shown that FGD5-AS1 is closely related to lymph node metastasis, tumor invasion, survival time, and recurrence rate of various cancers. Mechanism analysis showed that FGD5-AS1 induced cancer cell proliferation, metastasis, invasion and drug resistance in vitro, and promoted tumor growth and metastasis in vivo through stable mRNA expression of spongifying miRNA.
In addition, FGD5-AS1 can be used as a diagnostic or prognostic marker for a variety of cancers [28]. The expression abundance of most lncRNAs is low, which greatly limits their functional scope and influence. However, FGD5-AS1 is a highly expressed lncRNA [29]. FGD5-AS1, a promising lncRNA, has a wide range of targets and hence holds great potential for the creation of new and safe therapeutic techniques. However, limited study has focused on the profitability of FGD5-AS1 in AMI, and the probable mechanism has not been elucidated. This study shown that FGD5-AS1 can improve myocardium damage caused by acute myocardial infarction (AMI). Furthermore, FGD5-AS1 has the ability to reduce cardiomyocyte pyroptosis produced by H/R. These findings indicate that FGD5-AS1 may have a role in enhancing symptoms of AMI.
Mounting evidence has emphasized that lncRNA can mediate the expression of target microRNAs to achieve specific physiological functions. A prior work shown that FGD5-AS1 promotes cisplatin resistance in lung cancer cells through miR‑142‑5p [30]. Moreover, FGD5‑AS1 was showed to increase the invasion and migration of glioblastoma cells via miR-103a-3p [31]. Furthermore, it has been demonstrated that FGD5-AS1 influences the progression of periodontitis through its interaction with miR-142-3p [18]. Another new finding of this study is that FGD5-AS1 targets miR-424 expression.
Many researches showed that microRNA achieve their functions by mediating the expression of target mRNAs [32]. MiR-424 has been reported to regulate cardiomyocyte pyroptosis via targeting of CRISPLD2 [33]. In addition, miR-424 has been demonstrated to regulate cell cycle and inhibit cell proliferation via targeting E2F7 [34]. The confirmation of miR-424’s ability to target HOXA3 was achieved using luciferase activity assay, western blot assays, and qPCR assay. Moreover, it has been verified that FGD5-AS1 enhances the production of HOXA3 protein, whereas miR-424 suppresses the production of B-cell lymphoma-2 Like 13 (BCL2L13) protein. This confirms that FGD5-AS1 controls the expression of HOXA3 via targeting miR-424. Ultimately, it was verified that FGD5-AS1 promotes cell growth and reduces the inflammatory response and pyroptosis in cardiomyocytes produced by hypoxia/reoxygenation (H/R) via regulating the expression of miR-424/HOXA3.
5. Conclusions
In conclusion, we discovered that FGD5-AS1 can ameliorate myocardial damage caused by AMI. Moreover, FGD5-AS1 could significantly decrease H/R-induced cardiomyocyte pyroptosis, regulates HOXA3 expression by targeting miR-424, and alleviates H/R-induced cardiomyocyte pyroptosis by regulating HOXA3 expression. Finally, it has been demonstrated that dioscin effectively alleviates myocardial damage and cardiomyocyte pyroptosis caused by AMI, and regulates the expression of FGD5-AS1/miR-424/HOXA3 axis. The findings indicate that dioscin effectively reduces cardiomyocyte pyroptosis in rats with acute myocardial infarction (AMI) by modulating the LncRNA FGD5-AS1/miR-424/HOXA3 axis. Future studies should look at FGD5-AS1, miR-424, and HOXA3 as possible biomarkers of AMI and cardiomyocyte pyroptosis and evaluate their application value in early diagnosis and efficacy monitoring. In addition, clinical trials can be conducted to verify the efficacy and safety of dioscin in patients with AMI and explore its feasibility in clinical applications. Ultimately, novel drugs can be developed based on the FGD5-AS1/miR-424/HOXA3 axis, whiles exploring its potential in the treatment of AMI, and optimizing its drug delivery system to improve therapeutic efficacy.
Availability of data and materials
All data generated or analyzed during this study are included in this published article.
Author contributions
SJB and WC—designed the study, supervised the data collection. QW—analyzed the data, interpreted the data. HY, MJ and CML—prepare the manuscript for publication and reviewed the draft of the manuscript. All authors have read and approved the manuscript.
Ethics approval and consent to participate
Ethical approval was obtained from the Ethics Committee of the Second Affiliated Hospital of Chengdu Medical College (Approval No. 20230137).
Acknowledgment
Not applicable.
Funding
This work was supported by research grants from the Chengdu Key Medical Specialty Project (CDS2022Z076), grants from the Chengdu Key Clinical Specialty Project (CDS2023ZD002), grants from Chengdu Medical Research Project (No. 2023189) and the Sichuan Provincial Medical Research Project (No. S23030).
Conflict of interest
The authors declare no conflict of interest.
